=SUM(A6:19,sheet3!A12)
which part of the formula references the work sheet?​

Answers

Answer 1

Answer:

SHEET3!

Explanation:

Answer 2

Answer:

Its A - Sheet3!

Explanation:

On edge 2021


Related Questions

One advantage of putting information into a database is that you can filter the data.
O True
O False

Answers

Answer:

True.

Explanation:

One of the purposes of databases is to allow data lookup through queries, which is basically filtering data, using efficient algorithms too.

Answer:

True

Explanation:

PLEASE HELP AND HURRY!!!

Which command group on the Format tab of the SmartArt Tools contextual tab allows a user to change the fill and outline of SmartArt shapes?

Shapes
Shape Styles
Arrange
Size

Answers

Answer:

Shape Styles

Hope this helps :)

Mark me brainiest

Explanation:

The
feature in Photoshop will help Franklin see the printed version of the document on the screen before he actually prints it.

Answers

Answer:

print preview

Explanation: platooo

QUICKLY PLEASE!!!

Respond to the following in three to five sentences.

What is the purpose of netiquette guidelines?

Answers

Answer: As the conventional etiquette, which lays out rules of ethics in social contexts, the purpose of netiquette is to help create and sustain a friendly, relaxed and productive atmosphere for online contact, as well as to avoid putting pressure on the system and creating tension between users.

Explanation:

Why do you usually find domain names instead of IP addresses in a URL? Select one: a. An IP address would make your web page load more slowly b. A domain name is easier to remember C. An IP address is not guaranteed to get you to the right server computer d. Domain names are free, while IP addresses are very expensive ​

Answers

Answer:

b

Explanation:

for exaple brainly.com is easy to remember instead of 104.17.73.91

For which discipline is it most important to study computer technical support and networking?

Answers

Answer:

Studying computer technical support would contribute most to the disciplines of computer engineering and information technology.

have an amazing day! =)))

delete temp or %temp% files in Windows 10 is safe and, can it help boost up your PC fps?

yes or no

Answers

Answer:   yse

Explanation...

Images, symbols, and diagrams are types of

art objects
Graphs
graphics
presentation objects

Answers

Answer:

The answer to this question is given below in the explanation section.

Explanation:

The correct answer to this question is :

Graphics

Because Graphics are the visual representation of information without text. Images, symbols, and diagrams are types of graphics. These graphics can be used in presentations to present information visually.

While other options are not correct because:

Art objects are some images or painting that is the artistic creation of aesthetic value. While graphs are the visual presentation of data and there are different presentation objects in PowerPoint such as images, symbols, text, and diagrams, etc. But it is noted that images, symbols, and diagram are not types of presentation objects but it is a type of graphics elements/objects.

What is the purpose of concatenation?

To combine two variable names in order to form a string
To combine two or more strings into one big string
To pull out a group of characters from a string
To pull out one specific character from a string

Answers

Explanation:

Concatenation allows you to add multiple strings together to form one long string by using the '+' operator between each string, so the purpose of concatenation is "to combine two or more strings into one big string" (third option).

Hope this helps :)

What does the following loop do?

val = 0
total = 0

while (val < 10):
val = val + 1
total = total + val
print(total)

Prints the numbers backwards from 10 to 1.

Prints the sum of the numbers from 1 to 10.

Finds the average of the numbers between 1 and 10.

Prints the numbers from 1 to 10.

Answers

Answer:

Prints the sum of the numbers from 1 to 10.

Explanation:

YOU NEED BETTER INDENTATION

Total is the sum.

Each loop it's added

:)



The admission booth at the show requires each person to enter their age. Then the following program executes (See image.): When age = 16, what action would the program execute?



A. print “16”
B. print “Student price is $8.”
C. print “14”
D. print “Student price is $14.”

Answers

the data represented by numeric whole-number values, either positive or negative, that do not have decimal points

A. Boolean

B. string

C. Float

D. integer

What is another name for repetition in programming?

A. duplication

B. replication

C. redundancy

D. iteration

All of the following are types of errors in a computer program EXCEPT

A. syntax

B. parameter

C. semantic

D. logic

17.

What is one way that programmers insert explanatory statements in their code?

A. for loops

B. compiling code

C. use comments

D. create variables

18.

Why is readable code important? Choose all that apply.

A. It is more fun to write.

B. It makes the purpose and flow of a program easier to understand and follow.

C. Anyone needing to work with the code in the future will have an easier time.

D. It will save time when it is time to update the program.  (MAYBE D AS WELL) if u are allowed to select more than 2

19.

All of the following are true about debugging except

A. debugging is not a necessary process

B. it is a process of identifying and eliminating errors in a software program

C. it is essential to produce high-quality programs

D. eliminating bugs is an important part of the program development cycle

20.

The type of conditional statement that tests if a condition is true or false

A. if

B. not

C. or

D. and

24.

Which best describes a computer bug?

A. a piece of computer hardware that is out of date or has a newer version

B. a piece of computer software containing defects that prevent a program from running properly

C. a piece of computer hardware that is being used improperly

D. a piece of computer software that is out of date or has a newer version

25.

Which set of variables will make code easier to understand?

A. a, b, c

B. sum, price, count

C. xii, xix, xxi

D. x, y, z

23.

An argument is different from a parameter in that an argument

A. refers to a piece of data to be supplied.

B. is a placeholder for a constant value.

C. is the data passed into a parameter.

D. is always variable.

Answer:

B. print "Student price $8."

Explanation:

B

Carmen printed her PowerPoint presentation at home. Her mom was angry because Carmen used 20 pieces of paper and all the color ink. What option did Carmen most likely use to print
her presentation?
Print full page slides print handouts. Print note pages or print options will give Brainliest ANSWER

Answers

Answer:

She used 1 sided and color

Explanation:

those are the options she used

Carmen printed her PowerPoint presentation at home. Her mom was angry because Carmen used 20 pieces of paper and all the colored ink. She used 1 side and color.

What is the printer?

A printer is a device that receives the text and graphic output from a computer and prints the data on paper, typically on sheets of paper that are standard size, 8.5" by 11". The size, speed, sophistication, and price of printers vary.

One of the more frequent computer peripherals is the printer, which may be divided into two types: 2D printers and 3D printers. While 3D printers are used to produce three-dimensional physical items, 2D printers are used to print text and graphics on paper.

Therefore, at home, Carmen printed out her PowerPoint presentation. Carmen used 20 pieces of paper and all the color ink, which made her mother furious. She used color and one-sided.

To learn more about printers, refer to the link:

https://brainly.com/question/17136779

#SPJ2

In full verbatim, a person wants to say that they admitted him to a hospital last month. He makes a mistake about the date and quickly corrects himself. How should a correct sentence look like?

Answers

He should cancel the date and move to another country semis how he screwed up his work, hope this helped

Tell me everything that happened in the fortnight galactics event. WHO EVER HAS THE BEST EXPLANATION WILL GET BONUS POINTS AND WILL BE MARK BRAINLYNESS

Answers

Answer:

people still play fortnight?!?!

Explanation:

psn: Smallboy_life

Now it says this and the airplane mode option is dull

Answers

Explanation:

Click the airplane mode again and see if your internet turns back on. if not then click the internet symbol and check to see why its down.

Answer:

can't use internet on airplane mode that's for battery save or no services

HELP!!!

To help ensure that an HTML document renders well in many different web browsers, it is important to include which of the following at the top of the file.


A) an html tag

B) a doctype declaration

C) a body tag

D) a head tag

Answers

Answer:

The detail answer of this question is given in explanation section.

The simple answer is option B

Explanation:

Let took at each option:

A) an html tag

An html tag is used to start and end html document. It does not have anything to do with rendering.

B) a doctype declaration

The document type declaration is necessary because it tell the browser which version of html should be rendered.

C)Body tag tell the browser. it is the visible area of website.

D) A hear tag is used to clear meta data about website.

Answer:

I think it is:

B. a doctype declaration

Explanation:

Compare and contrast the advantages and disadvantages of the Windows, Apple and Linux operating systems.

Answers

In apple, you may do other things that windows can not provide. Yet, Windows are good aswell since it has better things than apple. I’m so sorry if i’m wrong.

what is electro magnetism

Answers

Answer:

Electromagnetism is a branch of physics involving the study of the electromagnetic force, a type of physical interaction that occurs between electrically charged particles

Explanation:

Answer:

malay ko di ko alam sagot dyan eh kaya isip ka rin ghourl

What is a product of respiration

Answers

Answer:

carbon dioxide and water

Explanation:

!PLEASE HELP! My business office specialist class, this is about Access.

Which settings are available in the Options dialog box? Check all that apply.

the name of the user or the initials
the images to include in a database
the object types to include in tables
the default format for new databases
the default folder for storing databases
the folders containing trusted databases
the number of databases to save in each folder

Answers

Answer:

b

Explanation:

Answer:

Probably late but the answers are

A: the name of the user or the initials

D: the default format for new databases

E: the default folder for storing databases

F: the folders containing trusted databases

Tenim tres resistors en sèrie, calcula la tensió que hi haurà a cadascuna d'elles sabent que una d'elles és de 680 Ω i les altres són de 220 Ω. El generador té una tensió de 12V.

Answers

Resposta:

Per a càrrega de 680Ω: 7,27 volts

Per a les dues càrregues de 220Ω: 2,36 volts cadascuna

Explicació:

Segons la llei d’ohms

E = IRt

E és la força electromotriu = 12V

I és el corrent total que circula al circuit

Rt és la resistència equivalent total

Com que els 680Ω, 220Ω i 220Ω estan en sèrie;

Rt = 680 + 220 + 220

Rt = 1120Ω

Obteniu el corrent total del circuit:

Recordem que: E = IRt

I = E / Rt

I = 12/1120

I = 0,0107A

Tingueu en compte que el mateix corrent flueix a través de resistències connectades en sèrie, però tensions diferents.

Obteniu les tensions individuals;

Per a càrrega de 680Ω;

V = IR

V = 0,0107 * 680

V = 7,27 Volts

Per a la càrrega de 220Ω

V = IR

V = 220 (0,0107)

V = 2,36 volts

Per tant, les tensions de les dues càrregues de 220Ω seran de 2,36 volts cadascuna

Some people recommend deleting social media accounts because of the troubling legal and ethical implications of social media. Do you support this position? Why or why not?

Answers

Answer:

I do not support this

Explanation:

One reason is because the benefits for social media out way the unbeneficial parts.one reason is because sites like social media have forever changed the life of many familys across the globe.

hi who plays among us

Answers

Answer:

Me

Explanation:

Lol

Answer:

used to, i like that the game is inexpensive and run well, i hate the thirst boys though

Explanation:

What pets are on Terraria and how can you get them?

Answers

Answer:

There are over 15 new pets that can be found in chests and dropped rarely off enemies: Baby Dinosaur, Baby Eater, Baby Hornet, Baby Penguin, Baby Skeletron Head, Baby Snowman, Baby Truffle, Black Cat, Eyeball Spring, Pet Lizard, Pet Parrot, Pet Sapling, Pet Turtle, Squashling, and Tiki Spirit.

Explanation:

Answer:

You can get some from the traveling merchant, others can be found by simply playing the game. Most bosses drop pets in master mode, and the EoW and BoC rarely drop pets in normal mode

Explanation:

To prevent the header from appearing on the title page of your document, select the______ option .
a. Different Odd and Even Pages
b. Different First Page
c. Position Grouping
d. Page Number​

Answers

Answer:

b. Different First Page

Complete the sentence.

A ___________search can be done on a list that is not ordered.

Answers

Answer:

Well, a binary search has to be ordered. So ima just say linear search..

Explanation:

I think its linear..

A binary search can be done on a list that is not ordered.

What is a binary search?

Binary search is a fast technique that finds an item from a sorted list of objects with a run-time complexity of O(log n), where n is the total number of elements. Divide and conquer concepts are used in binary search.

When performing a binary search on an array in computer programming, the array must be sorted in ascending order, i.e. from the least to the highest with respect to the data value.

The primary benefit of using binary search is that it does not scan every element in the list. Instead of scanning each element, it searches the first half of the list. As a result, a binary search takes less time to find an element than a linear search.

Therefore, the correct option is b, Binary.

To learn more about binary search, refer to the link:

https://brainly.com/question/28391940

#SPJ2

The question is incomplete. Your most probably complete question is given below:

•Linear

•Binary

company abc is buying computers for board members

Answers

Answer:

Not enough information.

Explanation:

Selena made a diagram to compare and contrast transmitters and receivers.

A Venn diagram of two ovals. The left oval is labeled Transmitters. The right oval is labeled Receivers. There is an X inside the overlap.

Which label belongs in the area marked X?

Amplifies radio waves
Demodulates radio waves
Sends out radio waves
Captures radio waves

Answers

Answer:

A. Amplifies radio waves

Explanation:

e2021

Answer:

its A on ED

Explanation:

You defined a class and saved it as shoe.py.
Which line of code will allow you to use the class in another program?
from shoeClass import *
O import shoe from
O from shoe import
O import shoeClass from

Please hurry

Answers

Answer:

Import shoeClass from

Explanation:

You defined a class and saved it as a shoe. The line of code that allows you to see the class in another program is import shoeClass from. The correct option is d.

What is programming?

A form of computer programming language known as procedural programming describes a number of well-planned actions and processes during the course of its development.

It includes statements, functions, and commands that are organized systematically to finish a computing task or program. Its main focus is on developing procedures.

While object-oriented programming is a type of programming where the emphasis is on creating objects as opposed to actions and data or logic. Its four guiding principles are encapsulation, abstraction, polymorphism, and inheritance.

Therefore, the correct option is d. import shoeClass from.

To learn more about programming, refer to the link:

https://brainly.com/question/14368396

#SPJ5

How many passes will it take to find the five in this list?

1, 5, 10, 15, 20, 22, 30
3

1

4

2

Answers

Answer:

1 im prety sure

Explanation:

Answer:

2

Explanation:

is the correct answer

good luck

Other Questions
thanks guys i only got one question wrong i cant find my answer. You should really give your people the answer they are looking fo instead of giving sujestions. Write the slope-intercept equation for the graph. Energy that is stored is called... Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC write a letter to your friend describing him/her about your country nepalGuys plz help me with this question write a letter about nepal. If u guys help me with this question i will make you brainliest and give 25 points. But its so urgent so plz do it fast. help child.......help me need help thank you very Which type of energies make up the mechanical energy of a roller coaster moving along a track? I need help with problem 8 with work shown and explanation ASAP PLEASE!!!!!!!! Number 21 plsss helppppp Please help me Solve the inequality.12 - }>8-23 Prada buys a designer phone case for $300. The phone case is a collector's item andtriples in price every 8 years. Which function will model the value of Prada's phone caseafter t years? What is the answer here? The value of a stock dropped a total of $18 over a 3-day period. Each day during this stretch the value dropped the same amount. What integer represents the change in the value of the stock after the first day? help meeeeeeeeeeeeeeeee plz Calculate the slope by picking two points from the table and using the slow formulaWhat is the slope of the table? SHOW WORKCircle the Y intercept on the table what is the Y intercept How did the Maryland Act of Toleration affect religion in the North American colonies? 1. 2, 5, 8, ... the 8th term2. 3, 5, 7, ... the 21st term__3. 9, 18, 27, ... the 10th term_4. 3, 9, 15, 21, ... the 50th term5. 3, 7, 11, 15, ... the 25th term Atoms and elements are examples of A. molecules. B. mixtures. C. compounds. D. pure substances.