Answer:
a. Sabita is blind from a diet devoid of fortified milk, animal products, or dark yellow and orange fruits and vegetables. - Vitamin A
Sabita is suffering from Vitamin A deficiency. A lack of Vitamin A usually shows itself with night blindness but can cause complete blindness if not acted upon quickly.
Vitamin A deficiency is quite common in developing or poorer nations such as the area Sabita is located and usually attacks children of women in their reproductive stage. Sources of vitamin A include; fortified milk, animal products and fruits and vegetables.
b. Sabita has an enlarged thyroid gland due to a dependence on unfortified salt. - Iodine
Iodine deficiency leads to an abnormal enlargement of the thyroid gland leading to a condition known as Goiter which presents itself as a big bulge in a person's neck. Iodine is usually placed in fortified salt along with iron to reduce iodine deficiency so Sabita's dependence on unfortified salt is robbing her of a great source of Iodine.
The condition in which the body is deprived of minerals, vitamins and other macro and micronutrients are called malnutrition.
The correct matches and their explanation are as follows:
a. The correct answer is:
Option 2. Vitamin A
Sabita is blind from meals deficient in fortified milk, animal products, fruits and vegetables due to Vitamin A deficiency.Night blindness is a common symptom of a Vitamin A deficiency.It is most common in developing regions due to the lack of proper meals. The best source of vitamin A is milk, fruits and animal products like eggs.b. The correct answer is:
Option 4. Iodine
Sabita has a swollen thyroid gland due to habituation on unfortified salt deficient in Iodine.Iodine deficient diet causes thyroid gland enlargement a disease called Goiter. This type of disease also affects glucose metabolism and weight.To learn more about malnutrition and diet follow the link:
https://brainly.com/question/10789147
Which structure is found in the cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell?
DNA
ribosomes
nucleus
mitochondria
Answer:
DNA
Explanation:
cytoplasm of a prokaryotic cell, but is not found in the cytoplasm of a eukaryotic cell.
Answer:
A- DNA
Explanation:
whats the answer guys help me out
Answer:
Read Exp:
Explanation:
1st one - Attracts Pollinators.
2nd one - Prevents water loss.
3rd one - Traps insects.
g The ____ ring is built onto ribose-5-phosphate of PRPP for its de-novo nucleotide biosynthesis, while the ring structure of the ______ bases are synthesized separately and then coupled to ribose-5-phosphate via the C-N glycosidic bond.
Answer:
The purine ring is built onto ribose-5-phosphate of PRPP for its de-novo nucleotide biosynthesis, while the ring structure of the pyrimidine bases are synthesized separately and then coupled to ribose-5-phosphate via the C-N glycosidic bond.
Explanation:
Purines are produced as bases attached to the ribose 5-phosphate (pentose sugar). The adenine and guanine nucleotides derive from inosine monophosphate (IMP), which is synthesized on an existing ribose-phosphate. Thus, purine bases are built on a ribose sugar that is directly attached to the pyrimidine ring. On the other hand, pyrimidines are produced from the carbamoyl phosphate precursor. In this case, the ribose-5-phosphate pentose sugar is attached after the pyrimidine ring is made.
Provide one example of quantitative data that can be collected when using a microscope?
Answer: there 3 ducks by the pond
Explanation:
Quantitative is numbers. how many.
The Middle Latitudes have:
Answer:
The Middle Latitudes have cyclones and anticyclones
Explanation:
The Middle Latitude is a spatial region of the earth which are found between the tropics and the polar circles.
The climate in this region of the earth is usually very windy thereby forming cyclones and in serious conditions typhoons and hurricanes. The Middle Latitude is thereby characterized by cyclones and anticyclones.
Restriction digest A:
ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC
How many bases are in the second fragment?
Answer:
This question seem incomplete
Explanation:
This question seem incomplete. However, if the strand of the second fragment is what is provided above, then the answer is 51
This strand/fragment is definitely a DNA strand because of the absence of uracil (U) or because of the presence of thymine (T). The four bases in a DNA are adenine (A), Thymine (T), cytosine (C) and Guanine (G). These bases also bind to one another in the pattern described below
A ⇆ T
G ⇆ C
Hence, the adenine (A) on one strand can only bind to thymine (T) on the complementary strand (and vice versa) while the guanine (G) on one strand can only bind to cytosine (C) on the complementary strand (and vice versa).
Hence, the letters seen is the question are representations of bases in a DNA strand/fragment. The number of letters/bases here are 51
Explain what, if any, is the issue facing DNA polymerase in regards to its 5’->3’ activity when replicating DNA.
Answer:
The two strands of DNA are replicated in different ways
Explanation:
DNA replication is a process that occurs during the S phase of the cell cycle that consists of making two identical copies of the double-stranded DNA molecule, which subsequently are distributed in the daughter cells during cell division. During this process, DNA polymerase can add nucleotides in 5' to 3' direction, but not in 3' to 5' direction. In consequence, the DNA strand that has 3’ to 5’ directionality can be synthesized directly, while the DNA template strand that has 5’ to 3’ directionality can't be synthesized in a continuous manner and thereby it is created by adding small DNA fragments, which are known as Okazaki fragments (150-200 nucleotides in size).
Which macromolecule forms a double layer as the primary structure of cell membranes?
fats
oils
phospholipids
steroids
Answer:
phospholipids
Explanation:
Answer:
C. phospholipids
Explanation:
The other person said it
Formula, name, and Group number of element needed for: (i) hypothyroidism - (ii) hypertension (iii) kidneys (iv) bones
Answer:
I) Hypothyroidism involves the insufficient production of thyroid in the thyroid gland which helps in the development of individuals. The element Iodine enhances the production of the thyroid.
I2- Iodine - Group number 17
Hypertension - Too much Salt which contains sodium in foods causes hypertension.
Na- Sodium- Group number 1
Bones require Calcium for its proper development and also helps to strengthen it.
Calcium - Ca- Group number 2
Kidney - Excess sodium in kidneys could result to kidney diseases which is why plenty of water should be taken to help the kidney from this element.
Na- Sodium- Group number 1
Which sequence shows a subsitutuon mutation
Answer: Actually the answer is D. It is supposed to be identical to the original, that is why it can be a substitute.
Explanation: I just took the test, this is 100% correct.
Brainliest please?
The sequence that shows substitution mutation is the sequence in option D.
What are the nucleotide bases?The DNA sequence is the sequence or pairing of DNA bases. RNA and DNA both are genetic materials and both are made up of nucleic acids made up of deoxyribose acid and iron is made up of ribonucleic acid.
DNA and RNA both contain four bases that are joined with hydrogen bond RNA contain uracil in the place of thymine and DNA contain timing all other bases are the same.
The base pairs are complementary to each other: Thymine: Adenine and cytosine: guanine. But in RNA, it is uracil with adenine. Guanine and cytosine are the same. So the adjacent base pairs will be adenine and uracil.
Therefore, the correct option is a sequence in option D.
To learn more about substitution mutation, refer to the link:
https://brainly.com/question/26486518
#SPJ2
Which describes the geological time of the first land plants? Conifers appeared after the first flowering plants. Conifers first appeared around 182 million years ago. The first flowering plants appeared around 240 million years ago. The first flowering plants were introduced toward the end of the Mesozoic era.
The geological time of the first land plants were introduced toward the end of the Mesozoic era.
What is Mesozoic era?This era is referred to as the age of Conifers and it lasted from about 252 to 66 million years ago.
In this era, there was the presence of most ancestors of plants and animals which is why it being a period where first land plants were introduced is appropriate.
Read more about Mesozoic era here https://brainly.com/question/4824228
ASAP Why is ATP used as an active energy source over glucose? A. It is more abundant in food sources. B. It releases its energy quickly in a single reaction. C. It releases its energy slowly through multiple reactions, allowing it to last longer. D. It has more energy.
Answer:
B.
Explanation:
Glucose is an organic molecule that stores ATP or energy while Adenosine triphosphate (ATP) is an energy-carrying molecule.
ATP used as an active energy source over glucose because ATP is a shorter process and releases energy in a single reaction as glucose first converted into ATP and then used as energy in cellular respiration.
Hence, the correct option is "B".
The anticodon (Select all that apply):
a. is a triplet of nucleotides in tRNA
b. determines the identity of the amino acid to be added to the peptide chain
c. is complementary to the codon
d. binds to the codon via hydrogen bonds
Answer:
choice A
Explanation:
An anticodon is a trinucleotide sequence complementary to that of a corresponding codon in a messenger RNA (mRNA) sequence. An anticodon is found at one end of a transfer RNA (tRNA) molecule.
If a cusp is lost during preparation, which matrix band would provide the best support while restoring
Answer:
I would use a specialized or preformed matrix for the posterior sector.
Explanation:
Losing a cusp is a much more critical situation, that is, there will be less tooth remnant and less resistance to functional and parafunctional forces.
The matrices that are usually used in the posterior sector are matrices that must be burnished and already come with a format to better restore the functional unit of the occlusal surface.
It is important to clarify that cusps are only in the posterior sector and not in the anterior sector.
The cusps, even if they have the most correct selection of the matrix, will fail in their restoration if they are not performed according to the patient's occlusion, under a good dental integration system such as adhesion through resins, and respecting the normal antomy of the piece to be restored.
The shape of the path of a planet or asteroid around the sun is an
In humans, a type of blindness is due to a dominant allele (B). Normal vision is the result of a
recessive allele (b). Migraine headaches are due to a dominant allele (M), and normal (no migraines)
is recessive (m).
A male who is heterozygous for blindness and does not suffer from migraines marries a woman who
has normal vision and does not suffer from migraines.
Could they produce a child with normal vision who does not suffer from headaches? If yes, can the
probability of such a child be determined?
You must draw a Punnett square within the space provided to receive any credit for your answer!
Answer:
Yes, a child with normal vision who does not suffer from headaches can be produced.
The probability of producing such child from this cross is 1/2 or 50%
Explanation:
This question involves two distinct genes in humans. One coding for blindness and the other for Migraine headaches. The alleles for blindness (B) and Migraine (M) are dominant over the alleles for normal vision (b) and no Migraine (m).
According to the question, a male who is heterozygous for blindness and does not suffer from migraines will have the genotype; Bbmm while a female who
has normal vision and does not suffer from migraines will have genotype; bbmm. If these two parents are crossed, the following genotypes of gametes will be produced by each parent:
Bbmm- Bm, Bm, bm and bm
bbmm- bm, bm, bm, and bm
Using these gametes to construct a punnet square (see attached image), the following offsprings with genotypes; Bbmm and bbmm in the ratio 1:1 will be produced.
Bbmm (8/16) are offsprings with blindness and have no Migraine headache
bbmm (8/16) are offsprings with normal vision and have no migraine headache
Hence, this cross can produce a child with normal vision who does not suffer from headaches (bbmm). Also, the probability of producing such child is 8/16 or 1/2.
Consider that a certain gene is a maternal effect gene and that the allele for dark brown pigment is incompletely dominant to the allele for no pigment (white). The incomplete dominant phenotype is light tan. If a white female is crossed with dark brown male, what will be the phenotypic ratio of the progeny?
A) all white
B) all dark brown
C) all light tan
D) either all white or all light tan
E) either all light tan or all dark brown
F) none of the above choices (cannot be determined)
Answer:
The correct answer is C. All light tan
Explanation:
You will find the answer and explanation in the attached file due to technical problems.
Diatoms are mostly asexual members of the phytoplankton. Diatoms lack any organelles that might have the 9 + 2 pattern. They obtain their nutrition from functional chloroplasts, and each diatom is encased within two porous, glasslike valves. Which question would be most important for one interested in the day-to-day survival of individual diatoms?A) How does carbon dioxide get into these protists with their glasslike valves?B) How do diatoms get transported from one location on the water's surface layers to another location on the surface?C) How do diatoms with their glasslike valves keep from sinking into poorly lit waters?D) How do diatoms with their glasslike valves avoid being shattered by the action of waves?E) How do diatom sperm cells locate diatom egg cells?
Answer:
Diatoms are mostly asexual members of the phytoplankton. Diatoms lack any organelles that might have the 9 + 2 pattern. They obtain their nutrition from functional chloroplasts, and each diatom is encased within two porous, glasslike valves. Which question would be most important for one interested in the day-to-day survival of individual diatoms?
C) How do diatoms with their glasslike valves keep from sinking into poorly lit waters?
Explanation:
Diatoms are some of the most important organisms living on earth because of its role on the oxygen production in the planet earth. The question "how do diatoms with their glasslike valves keep from sinking into poorly lit waters?" Because of the way their nutrition is obtained from functional chloroplasts and the way them encased within two porous, glasslike valves.
Before using any chemical in the lab, why should one first read the Material Safety Data Sheet (MSDS)?
The MSDS provides information on safe handling of the chemical.
The MSDS explains where the chemical can be purchased.
The MSDS provides the chemical formula for the substance.
The MSDS describes how the chemical will react with other substances.
Answer:
A
Explanation:
Took test on Edge.
Material Safety Data Sheet (MSDS) contains information related to occupational safety and health. The MSDS provides knowledge on the safe handling of chemicals. Thus, option A is correct.
What is MSDS?Material Safety Data Sheet (MSDS) is the data safety sheet that states the rules and details of handling and using the laboratory chemicals that are related to health. It is of great importance as it allows the learning of chemical hazards.
Before entering the lab and using the chemicals one should read the MSDS book so to get aware of the handling and precautions that have to be taken while performing any experiments. To work safely one should know its danger and should be prepared for emergencies.
Therefore, the MSDS provides knowledge on the handling of hazardous chemicals.
Learn more about MSDS here:
https://brainly.com/question/3282390
#SPJ6
You are observing a sample of cells in the lab to determine why they did not
divide properly. You notice that the chromosomes are lined up in the middle
of the cell, and the spindle fibers have extended towards them, but have not
attached. What could be damaged?
How are red blood cells able to move through narrow vessels to carry oxygen throughout a multicellular organism? (1 point) a)They are flexible because they lack a plasma membrane. b)They are small because they lack a nucleus. c)They are long and thin with a tail-like end. d)They are small because their organelles are smaller than those of other cells.
Answer:
The correct answer is - option B. They are small because they lack a nucleus.
Explanation:
Red blood cells or erythrocytes are specialized cell that produce in bone marrow and have specific role such as carrying oxygen from lungs to deliver it to the various organs and carry out carbon dioxide.
In mammals these cells lack cell organelles such as nucleus and mitochondria, a major factor that determined its smaller size. The size of RBC are move through narrow vessels throughout a organism because of its specific size and shape that provide it space for hemoglobin and allow to be flexible and bend to move through narrow vessels.
Thus, the correct answer is : option B. They are small because they lack a nucleus.
How does your body know when cells are missing
Answer:
Receptors provide information to nervous system about missing cells.
Explanation:
Your body know when cells are missing due to nervous system. The network of nervous system spreads throughout human body which provide information about what is going on in the body. If the cells are missing due to injury, the nervous system gives instruction to the body to produce more cells and transported that cells to the region where these cell are required. So receptors are responsible to provide information to nervous system about missing cells.
The body knows cells are missing as a result of the receptors sending
to the central nervous system.
The human body consists of cells which have neurons. These neurons are
responsible for the passage of messages and information to other parts of
the body.
When a cell is missing from the body, signals are passed to the central
nervous system which consists of the brain and spinal cord and they then
relay impulses which helps to fix the issue so as to ensure optimal
functioning of the body.
Read more on https://brainly.com/question/17150388
HELPPPPP Which of the following pieces of evidence supports that species change due to certain genetic variations? Darwin's theory of evolution was incorrect, as it did not account for variation in a species. Natural selection causes variation but cannot cause the evolution of a new species. Mutation and natural selection both cause changes in a population. Changes in a population abruptly occur as a direct response to the environment.
Answer:
D. Mutation and natural selection both cause changes in a population
Explanation:
I just took the test. Good luck! :)
The two evidences that supports the fact that species change due to certain genetic variations are that mutation and natural selection both cause changes in a population.
What is natural selection?Natural selection is the postulation by Charles Darwin that organisms that are more adapted to their environment live longer and reproduce hence pass on their favorable traits to their offspring.
The two evidences that supports the fact that species change due to certain genetic variations are that mutation and natural selection both cause changes in a population.
Learn more about natural selection: https://brainly.com/question/1657375
identify a probable reason that the dark moths survived while the light moths did not during the industrial revolution
Answer:
directional selection
Explanation:
The directional selection is a type of Darwinian selection where a particular phenotype is favored in the population, thereby modifying the allelic frequencies to increase the proportion of the favored phenotype. Biston betularia, also known as peppered moth, is a species that was influenced by directional selection in its recent past. Before the industrial revolution, the frequency of light-colored moths was predominant compared to the darker-colored phenotypes, because this color has higher adaptive fitness in a clean, no pollution environment, thereby light-colored moths were able to avoid predatory birds. However, during the industrial revolution, the frequency of dark-colored moths increased in response to pollution (i.e. darker environment), thereby conferring a higher adaptive fitness to darker phenotypes.
Answer:
Dark wings
Explanation:
Protein that accounts for why water can cross a membrane more quickly than expected is Group of answer choices
Answer:
The correct answer is "Aquaporin".
Explanation:
The missing options of this question are:
A. ATP synthetase
B. Aquaporin
C. The sodium-potassium pump
D. Integrin
The correct answer is option B. "Aquaporin".
Aquaporins are microscopic channels that belong to a family of proteins that form pores. Aquaporins are also known as water channels for its specific biological role of allowing water to cross the cell membrane. The presence of aquaporins explains why water can cross cell membrane more quickly than expected, since they function as regulators of water transference.
Predict what will happen to the following lung volumes and capacities during strenuous exercise. Assume that you are comparing from a baseline of normal resting respiration.
Lung Volume or Capacity Predicted change from resting baseline : Use Increase, Decrease or No Change
TLC (total lung capacity)
No change
VC (Vital capacity)
IC (Inspiratory capacity)
FRC (Functional residual capacity
TV (Tidal volume)
IRV (Inspiratory reserve volume)
ERV (Expiratory reserve volume)
RV (Residual volume)
Answer:
During intense exercise:
lung capacity increases
vital capacity increases
respiratory capacity increases
functional residual capacity increases
tidal volume increases
the inspiratory and expiratory reserve volumes decrease as does the residual volume.
Explanation:
Residual volumes decrease because having better lung capacity, better development of the secondary skeletal muscles that collaborate in expiration and inspiration, these are given in a better way, and more effectively.
If these processes take place more efficiently, their potentiality increases and expiration and inspiration move a large current of air into the lungs, thus leaving less reserve airs.
Those people who have increased exhalation or inspiration reserve, have a weak activity of the musculature in the processes and function as "stagnant air" which is synonymous with a lack of physical activity or aerobic capacity.
It is important to clarify that all the above processes are accompanied by an increase in the size of the chest cage
Transposons need to __________________ in order to limit their negative impact on the genome of the host cell. A. control their nucleotide length B. regulate their copy number C. control their target-site choice D. avoid transposing into their own genome
Answer:
The correct answer is B
Explanation:
Transposons need to regulate their copy number to avoid errors with chromosomal pairing during meiosis and mitosis such as unequal crossover.
A typical example of this error is called the Alu Sequence or Elements. Alu elements contain more than one million copies found everywhere in the genome of human beings.
Many inherited human diseases such as cancer are related to Alu insertions.
Cheers!
TIME PEM
01:57
The majority of early psychological research reflected the
A differences among males and females
В. concerns and interests of minorities
C. differences among various cultures
concerns and interests of white males
Explain why you selected the location recorded in Panel 1 as the ideal incubation site for culturing microbes?
Answer:
Due to optimum environment for microbes.
Explanation:
I selected Panel 1 as the ideal incubation site for culturing microbes because the environmental conditions such as temperature, humidity and nutrients medium etc are optimum. Microbes need a specific environmental conditions for its growth and development. If the environmental conditions are not suitable so it adversely affected the growth and development of microbes.
Which process involves a decrease in the dispersal of matter? Select the correct answer below: heat exchange between two solids
Answer:
The options are
A.heat exchange between two solids
B.the decomposition of a compound into its constituent elements
C.the precipitation of a solid
D.none of the above
The answer is
C.the precipitation of a solid
Dispersal of matter involves the process whereby there is more space occupied by the resulting element/compound than the initial one. For example the conversion of liquid to gas means that it has an increase in the dispersal of matter as the gas particles will contain more space when compared to a liquid.
Precipitation of a solid means conversion of a liquid to a solid. A liquid is known to contain more space which means there is a decrease in the dispersal of matter.
The process that involved the reduction in the dispersal of matter should be the precipitation of a solid
What is the dispersal of matter?It refers to the process in which it contains the additional space that should be occupied. Like the conversion of the liquid to gas represent there should be increment in the disperson of the matter since the particles of the gas comprise more space at the time when the comparison is to be done with the liquid. Here, precipitation of the solid represent the transformation of the liquid to the solid.
This question is incomplete. Please find the options below.
A.heat exchange between two solids
B.the decomposition of a compound into its constituent elements
C.the precipitation of a solid
D.none of the above
Learn more about dispersal of matter here: https://brainly.com/question/6529880?referrer=searchResults