Restriction digest A:

ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC

How many bases are in the second fragment?

Answers

Answer 1

Answer:

This question seem incomplete

Explanation:

This question seem incomplete. However, if the strand of the second fragment is what is provided above, then the answer is 51

This strand/fragment is definitely a DNA strand because of the absence of uracil (U) or because of the presence of thymine (T). The four bases in a DNA are adenine (A), Thymine (T), cytosine (C) and Guanine (G). These bases also bind to one another in the pattern described below

A ⇆ T

G ⇆ C

Hence, the adenine (A) on one strand can only bind to thymine (T) on the complementary strand (and vice versa) while the guanine (G) on one strand can only bind to cytosine (C) on the complementary strand (and vice versa).

Hence, the letters seen is the question are representations of bases in a DNA strand/fragment. The number of letters/bases here are 51


Related Questions

7.Which of the following factors does not cause weathering of rocks.
A. light
B. temperature
C. water
D. wind​

Answers

Answer:

Light I believe.

Explanation:

What does cyclical mean

Answers

Cyclical means occurring in cycles technically meaning reoccurring.

Food microbiologists are scientists who have a background in both microbiology and food science. They focus on how microbes grow, cause disease, and how they can be identified from food. Their work is of importance to the food industry as it relates to the production, preservation, and spoilage of food; and it is of importance to public health and regulatory agencies due to the many diseases that are related to food intake and consumption. Food microbiologists can have varying backgrounds, including training in veterinary medicine. This scenario is about a food microbiologist who works as a food safety inspector who pays a visit to a cheese manufacturing plant and makes some interesting discoveries!
Part A-Understanding the Role of Microbes in Fermentation The Midwest is known for its contribution to the dairy industry Fermented dairy products include milk, yogurt, and cheese. The fermentation process relies on lactic acid bacteria and pasteurization. Fermentation can vary based on what food is being produced, the type of bacteria used to produce lactic acid, and the time and temperature of pasteurization. It is important to the manufacturer to produce a product that won't spoil before it is packaged and sold and that won't result in disease for those who ingest and enjoy it. Julie, a food inspector for a local Michigan health department is going to a nearby cheese plant for a biannual inspection. When she gets there, she will take a tour of the plant and allow the operators to describe what makes their cheese so special. She will use what she understands about fermentation to inquire about their production practices Please sort the following statements as being true or false regarding fermentation and its role in food production. Please recall the role that microorganisms can play in the production of foods.
1. Fermentation allows for sugars to be broken down
2. Starter cutures are for the growth of pathogens or the food such as bread, vegetables, and n food Some grains, fruits, and
3. Fermentation can be used only to Bacteria ane the only have their own microbes that used in the Correct Statements

Answers

Answer:

Statements 1 is True.

Fermentation allows for sugars to be broken down

Statements 2 and 3 are false.

Starter cutures are for the growth of pathogens or the food such as bread, vegetables, and n food Some grains, fruits, and

3. Fermentation can be used only to Bacteria ane the only have their own microbes that used in the Correct Statements

Explanation:

In microbiology, fermentation is the process where sugars are broken down by the activities of bacteria to produce alcohol and carbondioxide...therefore statement one is true.

Starter culture are microorganisms use in diary production for producing yoghurt and cheese. They perform fermentation in diary production.

The linear strands of DNA in eukaryotes are efficiently packed within the nucleus of the cell. The packing of DNA strands is mediated by proteins called

Answers

Answer: Chromatin.

Hi! The answer you're looking for is chromatin.

Chromatin helps to organize DNA into the strands you're talking about, which are called nucleosomes.

Glad to help!

9. What types of resources are found in the Amazon jungle?

Answers

Answer:

               Metals like bauxite, gold, manganese, copper, tin and timber.

                 

                The Amazon Jungle is rich for logging , coffee growing , meat

               production and milk production.....

A purebred tall pea plant is cross-pollinated with a tall, heterozygous pea plant. Use a Punnett square to determine the probability the offspring inherita
recessive short allele. (I point)
75%
25%
0%
50%

Answers

Answer:

The correct answer is - 25%

Explanation:

A cross between true tall pea plant and heterozygous tall pea plant is the cross of tall allele whic is TT and heterozygous which is Tt, so the gametes will be formed would be - T and T by true tall plant and T, and t allele by heterozygous plant.

The Punnett square of this cross is attached with the answer, where 2 heterozygous offspring and two tall offspring produced. In which there is only two recessive short allele formed in this generation out of 8 alleles.

So the probability of short allele would be:

= (2/8) *100

= (1/4) *100

= 25%

You perform a test cross of the dihybrid AaBb and score the phenotypes of 1000 progeny. Assuming independent assortment, how many of the progeny do you expect to display the dominant phenotype for both the A and B genes?

Answers

Answer:

4

Explanation:

The number of progeny expected to display the dominant phenotype for both the A and B genes should be  4.

A test cross usually involves crossing an individual whose zygosity is in doubt with an individual that is recessive for both alleles so as to ascertain the zygosity of the former. Hence, for a test cross involving AaBb:

             AaBb     x     aabb

Progeny:

4 AaBb

4 Aabb

4 aaBb

4 aabb

Therefore, the number of progeny expected to display the dominant phenotype for both the A and B genes is 4.

Diatoms are mostly asexual members of the phytoplankton. Diatoms lack any organelles that might have the 9 + 2 pattern. They obtain their nutrition from functional chloroplasts, and each diatom is encased within two porous, glasslike valves. Which question would be most important for one interested in the day-to-day survival of individual diatoms?A) How does carbon dioxide get into these protists with their glasslike valves?B) How do diatoms get transported from one location on the water's surface layers to another location on the surface?C) How do diatoms with their glasslike valves keep from sinking into poorly lit waters?D) How do diatoms with their glasslike valves avoid being shattered by the action of waves?E) How do diatom sperm cells locate diatom egg cells?

Answers

Answer:

Diatoms are mostly asexual members of the phytoplankton. Diatoms lack any organelles that might have the 9 + 2 pattern. They obtain their nutrition from functional chloroplasts, and each diatom is encased within two porous, glasslike valves. Which question would be most important for one interested in the day-to-day survival of individual diatoms?

C) How do diatoms with their glasslike valves keep from sinking into poorly lit waters?

Explanation:

Diatoms are some of the most important organisms living on earth because of its role on the oxygen production in the planet earth. The question "how do diatoms with their glasslike valves keep from sinking into poorly lit waters?" Because of the way their nutrition is obtained from functional chloroplasts and the way them encased within two porous, glasslike valves.

Describe the transport properties of the loop of Henle and explain the interactions between the ascending and descending limbs

Answers

Answer:

The loop of henle is a part of the renal functional unit.

This handle has an ascending part and a descending part.

In the descending loop, the urine that is formed inside enters a hypotonia, since a large amount of water is absorbed and the concentrations of solutes in the urine decrease, thus generating a hypoosmolar solution, that is, with less molarity.

In the ascending loop of henle, the opposite arises, ionic channels appear that increase the concentration of solutes, this is how the urine that runs through the interior of the ascending loop of henle becomes hyperosmolar.

Hyperosmolarity is the increase in concentrations of solutes, and the increase in molarity of the solution, which in this case would be urine.

Explanation:

A very important fact is that urea is absorbed in the ascending henle loop.

what are some questions an environmental biologist might ask about qhat they are studying

Answers

they could ask what biology is? what the meaning of biology us?

Lactose (milk sugar) is a carbohydrate that is formed by combining galactose and glucose. Which term best describes this molecule?

Answers

Answer:

disaccharide

Explanation:

A disaccharide is a form of sugar that is made up of the combination of two other sugar molecules that are simple. They possess the property to dissolve easily in water. The process that occurs to join the two simple sugars includes the removal of water from the molecules. Sucrose, lactose, and maltose are the three disaccharides.

Answer:

disaccharide

Explanation:

A disaccharide is a form of sugar that is made up of the combination of two other sugar molecules that are simple. They possess the property to dissolve easily in water. The process that occurs to join the two simple sugars includes the removal of water from the molecules. Sucrose, lactose, and maltose are the three disaccharides.

. Buffer solution resists change to its pH when small amounts of an acid or an alkali are added to it. Buffer solutions can be used to keep the pH of a substance constant during an experiment. For example, if pH 5.5 buffer solution is added to a mixture of amylase and starch solution, the pH of the mixture will remain constant at 5.5. The student has the following buffer solutions available: 5.5, 6.0, 6.5, 7.0, 7.5 and 8.0. Describe how the student can adapt the tube experiment to investigate the effect of pH on the action of amylase.

Answers

Answer:

hey

Explanation:

Help with this please anyone!!!

Answers

Answer:

top right

Explanation:

HELP!!! Plato Biology closed out and all I had left was Final. Anyone have examples of the 50 questions so I can study

Answers

Answer:

Explanation:

Are gender traits completely a result of societal expectations?

Are there any parts of the human body that get oxygen directly from the air and not from the blood?

Are there nuclear reactions going on in our bodies?

Can humans ever directly see a photon?

Can I turn my cat into a diamond?

Do blind people dream in visual images?

Do Kirlian photographs show the soul of an organism?

Do koalas eat honey like other bears?

Do poppy seeds contain narcotics?

Does the human body contain minerals?

How can the heart be strong enough to pump blood up your legs against gravity?

How can we differentiate so many different foods if we can only taste four flavors on our tongue: sweet, bitter, sour, and salty?

How can we unlock the 90% of our brain that we never use?

How did doctors create my belly button?

How did evolution ever lead ostriches to hide their head in the sand when an enemy approaches?

How do I turn on more parts of my brain and get smarter?

How do nerves control every organ and function in the body?

How do trees give earth all its oxygen?

How does the outer layer of skin cells on my finger detect when I am touching an object?

How long before genetic sequencing is able to tell us exactly how our children will look and act?

How long does it take our eyes to fully adapt to darkness?

How much water can a camel store in its hump?

How strong does a non-toxic odor have to be before it damages your sense of smell?

Is human blood ever any color other than red?

Is ionizing radiation always harmful?

Is it completely random whether a baby is a boy or a girl?

What are the five senses of the human body?

What chemicals can make human tissue regenerate in seconds?

What is it about a full moon that makes people do crazy things and commit crimes?

What is it about red that makes bulls so angry?

When did humans stop evolving?

When do birds use their teeth?

Where in my body is the original cell from which I was formed?

Why are bats blind?

Why are human brains the biggest?

Why are red, yellow, and blue the primary colors in painting but computer screens use red, green, and blue?

Why are veins blue?

Why can only certain parts of the tongue taste sweet flavors? Is there an evolutionary benefit to this?

Why can you boil a frog without it jumping out to safety if you raise the temperature slowly?

Why can't color blind people see any colors?

Why did evolution create a chicken that lays so many unfertilized eggs when that is so wasteful?

Why do camera flashes make your eyes turn red?

Why do humans have an appendix even though it is unnecessary?

Why do my fingers absorb water and become wrinkled?

Why does chewing gum take seven years to digest?

Why does every cell in our body contain DNA?

Why does evolution always lead to more advanced species?

Why don't dogs sweat?

Why don't I burst cells in my rear when I sit down?

Why don't our eyeballs fill up with water when we swim?

Why don't trees freeze and burst in the winter like cold pipes?

Why have humans evolved to be taller over the last three hundred years?

Why will a mother bird abandon its chick if touched by a human?

how can an objects volume be determined using water displacement ?

Answers

Answer:

Using a graduated cylinder.

Explanation:

By using a graduated cylinder we can determine the volume of liquids.

(1)Volume of liquid=10cm^3

(2)Volume of liquid after adding an irregular substance exceeds the first one by 20cm^3

(1)V+(2)V=(3)Vtotal

10cm^3+20cm^3=30cm^3

Hope this helps ;) ❤❤❤

A red flower producing snapdragon plant is crossed with a white flower producing snapgragon plant. Resulting F1 generation is crossed with one another to produce F2 generation.

This is incomplete dominance of genes.

Q1 What type of a breeding is this? (monohybrid, dihybrid or interspecific)

Q2 Draw a genetic chart to show P, F1 and F2 generations clearly indicating genotypes, phenotypes and generations.



Answers

Answer:

See the answer below

Explanation:

1. This is an example of monohybrid breeding. A monohybrid breeding is the type of breeding that involves parents with a pair of contrasting characters. On the other hand, a type of breeding involving a single gene is what is known as monohybrid breeding.

2. When a red flower snapdragon is crossed with a white flower snapdragon, the resulting offspring are usually pink - an indication of incomplete dominance of the gene responsible for flower color. Assuming the red flower's genotype is AA and that of the white flower is aa:

                       AA      x      aa

                 Aa      Aa      Aa      Aa

F1 genotype = all Aa

F1 phenotype = pink flower

At F2:

                          Aa      x      Aa

                 AA         2Aa           aa

F2 Genotype/phenotype:

       1AA - red color

       2Aa - pink flower color

        1 aa - white flower color.

Which statement best describes a hypothesis?

Answers

Answer:

A hypothesis is an idea or explanation you can test through study and experimentation.

Explanation:

Which type of muscle contracts without nervous stimulation?

Answers

Answer:

the answer is the cardiac muscle

Sabita is a mother in Nepal. She lives in poverty in the Western part of the country with her two children. Everyone in her family has some degree of malnutrition or nutrient deficiency. Match each of the following deficiency diseases with its corresponding nutrient.

a. Sabita is blind from a diet devoid of fortified milk, animal products, or dark yellow and orange fruits and vegetables.
b. Sabita has an enlarged thyroid gland due to a dependence on unfortified salt.

Nutrient:
1. Iron
2. Vitamin A
3. Vitamin D
4. Iodine

Answers

Answer:

a. Sabita is blind from a diet devoid of fortified milk, animal products, or dark yellow and orange fruits and vegetables. - Vitamin A

Sabita is suffering from Vitamin A deficiency. A lack of Vitamin A usually shows itself with night blindness but can cause complete blindness if not acted upon quickly.

Vitamin A deficiency is quite common in developing or poorer nations such as the area Sabita is located and usually attacks children of women in their reproductive stage. Sources of vitamin A include; fortified milk, animal products and fruits and vegetables.

b.  Sabita has an enlarged thyroid gland due to a dependence on unfortified salt. - Iodine

Iodine deficiency leads to an abnormal enlargement of the thyroid gland leading to a condition known as Goiter which presents itself as a big bulge in a person's neck. Iodine is usually placed in fortified salt along with iron to reduce iodine deficiency so Sabita's dependence on unfortified salt is robbing her of a great source of Iodine.

The condition in which the body is deprived of minerals, vitamins and other macro and micronutrients are called malnutrition.

The correct matches and their explanation are as follows:

a. The correct answer is:

Option 2. Vitamin A

Sabita is blind from meals deficient in fortified milk, animal products, fruits and vegetables due to Vitamin A deficiency.

Night blindness is a common symptom of a Vitamin A deficiency.

It is most common in developing regions due to the lack of proper meals. The best source of vitamin A is milk, fruits and animal products like eggs.

b. The correct answer is:

Option 4. Iodine

Sabita has a swollen thyroid gland due to habituation on unfortified salt deficient in Iodine.

Iodine deficient diet causes thyroid gland enlargement a disease called Goiter. This type of disease also affects glucose metabolism and weight.

To learn more about malnutrition and diet follow the link:

https://brainly.com/question/10789147

what organ lies over the surface of the heart​

Answers

Answer:

lungs

Explanation:

The role of the ___________ branch of the autonomic nervous system mediates control of organ processes when the body is essentially ______.

Answers

Answer: parasympathetic; at rest

Explanation: The parasympathetic nervous system branch of the autonomic nervous system is largely responsible for the relaxation of the body especially at rest where it undoes the activities of the sympathetic branch by decreasing respiration, heart rate and then increasing the body's digestion rate. As such, this branch is also responsible for digestion response in a relaxed, resting, or feeding states. The role therefore of the parasympathetic branch of the autonomic nervous system mediates control of organ processes when the body is essentially at rest.

Biologists designed an experiment to test the effects of compost on the development of root crops

Answers

Answer:

The crop has good yield because Compost has a good effect on root crops.

Explanation:

Compost has a great effect on the development of root crops such as onion, potato, garlic and ginger etc. Compost provide nutrients to these crops as well as soften the soil due to which they grow rapidly. It also improved ventilation, soil structure and soil texture which is very necessary for the crop. Due to ventilation, oxygen gas is available to the roots which increases growth and yield of these crops. Compost also retain water and nutrients so they are available to the roots. So those plots where compost is applied observed increase in yield as compared to other plots.

Volcanic eruptions are events that take place inside Earth’s . When they occur on land, they spew tremendous amounts of gas, releasing matter into the . The hot, flowing lava also disrupts the by destroying any vegetation and animals in its path.

Answers

Answer:

Volcanic eruptions are events that take place inside Earth’s GEOSPHERE. When they occur on land, they spew tremendous amounts of gas, releasing matter into the ATMOSPHERE. The hot, flowing lava also disrupts the BIOSPHERE by destroying any vegetation and animals in its path.

Explanation: I was taking the test and got it right so I thought I could help anyone who needs it

who invented biology

Answers

Answer:

The term biology in its modern sense appears to have been introduced independently by Thomas Beddoes (in 1799), Karl Friedrich Burdach (in 1800), Gottfried Reinhold Treviranus (Biologie oder Philosophie der lebenden Natur, 1802) and Jean-Baptiste Lamarck (Hydrogéologie, 1802).

Explanation:

When was biology invented?

Antiquity

The science of biology was invented by Aristotle (384–322 BC). Before Aristotle, many Greek philosophers had speculated about the origins of the Earth and of Life, but their theorizing was unsupported by empirical investigation.

The diagram represents a food pyramid. The concentration of the pesticide DDT in individual
organisms at level D is higher than the concentration in individuals at level A because DDT is
A. produced by organisms at level C ingested by
those in level D.
B. passed through levels A, B, and C to organisms
at level D.
C. excreted by organisms at level A as a toxic
waste.
D. synthesized by organisms at level D.

Answers

Answer:

B. passed through levels A, B, and C to organisms

Explanation:

DDT is an insecticide that passed through the food chain from one trophic level to the next.

The concentration of DDT increases with the each trophic level in food chain and the amount of toxin increases as passes from A to B, B to C, and C to D where D has the higher concentration of DDT as it is the higher trophic level than A, B, and C.

Hence, the correct answer is "B. passed through levels A, B, and C to organisms".

For lions how can we determine who the father is

Answers

umm we need an example

which compound is produced during regeneration​

Answers

Answer:

RuBP

Explanation:

Ribulose 1,5-bisphosphate (RuBP) is an organic substance that is involved in photosynthesis. It is a colourless anion, a double phosphate ester of the ketopentose (ketone-containing sugar with five carbon atoms) called ribulose. Salts of RuBP can be isolated, but its crucial biological function happens in solution.

What is the correct formula for population growth? A. D+B-I-E B. E+D-B-I C. B+I-D-E D. I+E-B-D

Answers

Answer:

C.) B+I-D-E

Explanation:

The correct formula for population growth is the individuals added to the population via birth or immigration, minus the individuals removed from the population via death or emmigration. Therefore the answer is (B+I)-(D+E), or B+I-D-E

Question 8 of 10
What three things most directly affect carrying capacity?
A. Wood, electricity, and water
B. Money, medicine, and food
C. Water, money, and technology
D. Food, space, and water
SUBMIT

Answers

Answer:

food space and water

Explanation:

Which statement about malaria and sickle-cell anemia is correct? (1 point)
Malaria causes a decreased incidence of sickle-cell anemia,
Sickle-cell anemia causes an increased incidence of malaria.
Sickle-cell anemia is correlated with an increased incidence of malana
Malaria is correlated with a decreased incidence of sickle cell anemia

Answers

Answer:

sickle cell anemia cause an increase risk of malaria

Explanation:

Other Questions
Mollys house is located at point X. Molly wants Sophia and Cole to meet at her house because she thinks it is the same distance from Sophias house and Coles house. Which could prove that Mollys house is the samedistance from Sophias and Coles houses? In regard to OCD, when the term "magical" is used to refer to compulsive acts, it means Group of answer choices the person with OCD believes he/she is possessed. compulsive behaviors are similar to superstitions. the compulsions have no logical relation to the obsessions. many magicians have been diagnosed with OCD. Which event launched the impeachment process against President Nixon?the Watergate break-in by burglars funded by CREEPthe Washington Post articles about the CREEP connectionthe discovery that the president was involved in a cover-up plotthe agreement by President Nixon to hand over the secret tapes Two samples from the same population both have M = 84 and s2 = 20, but one sample has n = 10 and the other has n = 20 scores. Both samples are used to evaluate a hypothesis stating that = 80 and to compute Cohens d. How will the outcomes for the two samples compare? Raw celery has a slight sparkle, a zingy taste that you don't get in cooked celery. When Mrs. Gleason came around with the relish tray, we each took another stalk of celery, except my brother. He took two. "The All-American Slurp," Lensey Namioka What does the word stalk mean in this sentence? Need help pleases 5 stars The phase sequence of a 3-phase system for which VAN = 120 /90o V and VBN = 120 /210o V is:_______ a) bca b) abc c) cab d) acb For the following system, if you isolated x in the first equation to use the substitution method, what expression would you substitute into the second equation?x + 2y = 63x + y = 8 religion, the idea that a person can be saved from sin and go to heaven. Using fluorescent imaging techniques, researchers observed that the position of binding sites on HIV peptides is approximately Normally distributed with a mean of 2.45 microns and a standard deviation of 0.35 micron. What is the standardized score for a binding site position of 2.03 microns? (Enter your answer rounded to one decimal place.) Which of the following activities meets the federal definitions of research? Each lap around a park is 1 15 miles. Kellyn plans to jog at least 7 12 miles at the park without doing partial laps. How many laps must Kellyn jog to meet her goal? Please answer this correctly without making mistakes Davids family is driving from New York to Florida. They know the distance they will travel is about 1100 miles . If a map has a scale of 1 in = 80 mi about how far will the trip be on the map ? Why did people domesticate plants?A. They were more flavorful.B. They were a reliable food supply.C. They made it easier to migrate.O D. They wanted to live in a variety of environments. Given that f(x)=2x+1 and g(x)=-5x+2 slove for f(g(x)) when x=3 every driver must show proof of insurance use correct grammer 03/08/2020Question 1.(a) State the definition of a chemical formula.(b) What does it tell about a compound?(c) What information is conveyed by the formulation H2SO4? An electron and a proton both moving at nonrelativistic speeds have the same de Broglie wavelength. Which of the following are also the same for the two particles? (A) speed(B) kinetic energy (C) frequency (D) momentum What are the two most predominate climates of Eastern United StatesTropical Savanna & Humid ContientalSteppe and DesertHumid Continental & Humid SubtropicalMarine West Coast & Mediterranean