QUADRATIC FORMULA SIMPLIFIED PLZ HELP

QUADRATIC FORMULA SIMPLIFIED PLZ HELP

Answers

Answer 1

Answer:

3x² + 5x + 1 = 0 simplifiedx = (-5 ± [tex]\sqrt{13}[/tex])/6 roots

Step-by-step explanation:

Given quadratic formula

3x² + 5x - 5 = - 6

Standard form

ax² + bx + c = 0

Simplifying

3x² + 5x - 5 + 6 = 03x² + 5x + 1 = 0

Solving

x = (-5 ± [tex]\sqrt{5^2 -4*3*1}[/tex])/(2*3)x = (-5 ± [tex]\sqrt{13}[/tex])/6

Related Questions

A stray dog ate 30 of your muffins. That was 5/7 of all of them! How many are left?

Answers

Answer:

42

Step-by-step explanation:

5/7x=30

x=42

Answer:

40

Step-by-step explanation:

What is the value of A in the equation shown?​

Answers

Answer:

is this algebra 1

Step-by-step explanation:

Answer:

The answer is 1

Step-by-step explanation:

you isolate the variable by dividing each side

PLEASE HELP MEE!!!!!!!!Joshua is 11 years old, and his dad is 33
years old. What is the ratio of Joshua's
age to his dad's age?

Answers

Answer:

11:33 or in simplified terms 1:3

Step-by-step explanation:

Hope this helps!:)

Express 44 copies in 4 minutes as a unit rate.

Answers

Answer:

11:1

Step-by-step explanation:

For every 11 copies, 1 minute passes. Four minutes passed in this case and thus 11*4 would equal 44 and 1*4 would equal 4.

Checking accounts can be accessed using checks, ATM machines, and wire transfers.
True or false

Answers

Answer:

I think it is True

What is a fraction equivalent to 4/4? Explain how you know.

Answers

Answer:  Any number over itself is equivlent to 4/4.

Examples: 3/3, 18/18, 5/5, 90/90

Step-by-step explanation:

Because 4/4 is equivalent to 1 whole.

A fraction that is equivalent to 4/4 would be, 5/5 as, After simplifying the fraction 5/5 is equal to 1.

A fraction is a part of the whole number and a way to split up a number into equal parts. Or, A number which is expressed as a quotient is called a fraction.

Given that,

The fraction is,

⇒ 4/4

Now, after simplifying the fraction we get;

⇒ 4/4

⇒ 1

So, Let a fraction that is equivalent to 4/4 would be;

⇒ 5/5

After simplifying we get;

⇒ 5/5 = 1

Therefore, A fraction that is equivalent to 4/4 would be, 5/5

To learn more about the fraction visit:

https://brainly.com/question/5454147

#SPJ6

Which phrase best completes the list?

Types of Expenses - Taxes

Apply to money earned and spent

Usually take up about 14 percent of a person's income

?

A. Are paid to the government
B. Allow a person to buy a home
C. Pay for vital services like water
D. Do not need to be paid every year

Answers

Answer:a

Step-by-step explanation:

The solution is, O A. Are paid to the government, the phrase best completes the list. Types of Expenses.

Here, we have,

Explanation:

Utilities are expenses on essential and vital services common to households and businesses. They include water and sewage bills, electricity bills, and garbage disposal expenses. A firm offering such services generate utility bills. The cost covers a regular period, say mostly monthly.

Heating and internet or data costs are also being considered as utility expenses. They are common and essential for domestic and business use.

To learn more on Types of Expenses click:

https://brainly.com/question/20281394

#SPJ7

-9h - 15 = 93 Need help. Not that good at solving two step equations. Algebra's tricky. Please solve.

Answers

Answer:

h=12

Step-by-step explanation:

first you want to isolate the variable. since you are subtracting 15, you wanna add fifteen to the 93 and cancel it out on the other side of the equation symbol. that equals 108. how since you are doing 9*h you divide on the opposite side of the equation so 108/9=12. the 9 cancels out meaning h=12

Please help me ASAP
How many pavers are needed to cover the patio?

Answers

Answer:

270

Step-by-step explanation:

✔️Area of the Patio = bh

b = 12 ft = 144 in.

h = 10 ft = 120 in.

Area of Patio = 144*120 = 17,280 in.²

✔️Area of Brick Paver = bh

b = 8 in

h = 8 in

Area of the Brick Paver = 8*8 = 64 in.²

The number of quaver needed to cover the Patio = area of Patio ÷ area of one brick quaver

= 17,280/64 = 270

Write the number below in expanded notation 75,966

Answers

7.596 to the 4th power

Use place value multiplication with powers of 10 or equivalent fractions to explain what is happening mathematically to the decimal points in the divisor and the dividend before dividing

Answers

Answer:

436.8 x 100 / 62.08 x 100 = 43680/6208

Step-by-step explanation:

When you write the problem as a fraction, multiply the numerator and denominator by 100.  Multiplying each by 100 resulted in both numbers being whole numbers. 436.8/62.08 is the same as 43,680/6,208.

Help me pleaseee (10 points)

Answers

Answer:

Step-by-step explanation:

tan(16)=125/a

tan(16)=35.8 (DC)

tan(7)=125/a

tan(7)=15.3

35.8-15.3=20.5

Sorry if that's incorrect, my best is 20.5 feet.

Answer:   approximately 582 feet.

======================================================

Work Shown:

Let

x = length of AD in feet

y = length of DC in feet

x and y are positive real numbers.

For now, focus on triangle BCD. Ignore point A and its associated angle.

tan(angle) = opposite/adjacent

tan(D) = BC/DC

tan(16) = 125/y

y*tan(16) = 125

y = 125/tan(16)

y = 435.926805480113

y = 435.926805

The value of y is approximate

Now focus on triangle ABC. Ignore point D and its associated angle.

tan(angle) = opposite/adjacent

tan(A) = BC/AC

tan(A) = BC/(AD+DC)

tan(7) = 125/(x + y)

(x+y)*tan(7) = 125

x*tan(7) + y*tan(7) = 125

x*tan(7) = 125 - y*tan(7)

x = ( 125-y*tan(7) )/( tan(7) )

x = ( 125-435.926805*tan(7) )/( tan(7) )

x = 582.116498496824

x = 582

The distance from A to D is approximately 582 feet.

Jimmy scored 49 goals in soccer this season.tommy scarred 7 times fewer goals how many goals did tommy score

Answers

i do not know how to play soccer but if you are only subtracting 7 from 49, the answer would be 42.

so my answer is 42 unless you aren’t supposed to subtract
Your answer is gonna be 42 !

Determine if the number is a negative or positive integer. Gain 4 yards in the last down.

Answers

Answer:

Positive

Step-by-step explanation:

It's positive because the person is gaining 4 yards, not losing it.

7•7•7•7+1+1 exponent

Answers

wdym- i don’t get the question...

Answer:

The right answer is 2,403

Step-by-step explanation:

A roof rises 15 feet vertically and 12 feet horizontally. What is the slope of the​ roof?

Answers

Answer: 15/12 or in simplest form its 5/4

Step-by-step explanation:

Slope is rise/run

Answer:

Do you know rise over run?? The roof goes up 15 feet and to the left or right 12 feet... the slope would be 15/12 or it would be 1.25 (when divided). Hope it helps!

Step-by-step explanation:

3x + 1 = 3(x - 1) + 4​

Answers

Simplifying

3x + 1 = 3[x + -1] + 4

Reorder the terms:

1 + 3x = 3[x + -1] + 4

Reorder the terms:

1 + 3x = 3[-1 + x] + 4

1 + 3x = [-1 * 3 + x * 3] + 4

1 + 3x = [-3 + 3x] + 4

Reorder the terms:

1 + 3x = -3 + 4 + 3x

Combine like terms: -3 + 4 = 1

1 + 3x = 1 + 3x

Add '-1' to each side of the equation.

1 + -1 + 3x = 1 + -1 + 3x

Combine like terms: 1 + -1 = 0

0 + 3x = 1 + -1 + 3x

3x = 1 + -1 + 3x

Combine like terms: 1 + -1 = 0

3x = 0 + 3x

3x = 3x

Add '-3x' to each side of the equation.

3x + -3x = 3x + -3x

Combine like terms: 3x + -3x = 0

0 = 3x + -3x

Combine like terms: 3x + -3x = 0

0 = 0

This equation is an identity, all real numbers are solutions.

Order of Operations with and without variables

Answers

I think the answer is -4

Help people help!!!!

Answers

Answer:

I think that it is

C

Please let me know if it is not correct!!!!

Answer:

A would most likly be the answer

Step-by-step explanation:

because in the equation sinse A =  -5 1/4 which is whe he was at the end hopefully you understand

Question 1) In an auditorium, there are 22 seats in the first row and 28 seats in the second row. The number of seats in a row continues to increase by 6 with each additional row. A) Write an iterative rule to model the sequence formed by the number of seats in each row. Show your work. (B) Use the rule to determine which row has 100 seats. Show your work. ( No Plagiarism and only answer if you know how to work this problem out. Will Mark Brainliest).​

Answers

Answer: Row 14

Step-by-step explanation:

Row 1= 22

Row 2= 28

Row 3= 34

Row 4= 40

Row 5= 46

Row 6= 52

Row 7= 58

Row 8= 64

Row 9= 70

Row 10= 76

Row 11= 82

Row 12= 88

Row 13= 94

Row 14= 100

This question is based on the sequence. Thus, the  row 14 has 100 seats.

Given:

In an auditorium, there are 22 seats in the first row and 28 seats in the second row. The number of seats in a row continues to increase by 6 with each additional row.

Now calculated the A part of the question.

According to the question,

By using iterative rule to model the sequence formed by the number of seats in each row.

Row 1= 22 Row 2= 28 Row 3= 34 Row 4= 40 Row 5= 46 Row 6= 52 Row 7= 58 Row 8= 64 Row 9= 70  Row 10= 76 Row 11= 82 Row 12= 88 Row 13= 94 Row 14= 100

(B) By using rule , we observe that row 14 has 100 seats.

For more details, prefer this link:

https://brainly.com/question/7854718

what is 494 divided by 6.5

Answers

Answer:

76

Step-by-step explanation:

Answer:

494 divided by 6.5 =76

Step-by-step explanation:

how can i solve -4.6x = -11.04

Answers

Answer:

The last one

Step-by-step explanation:

Answer:

D, Divide both sides by -4.6

Step-by-step explanation:

You want to get the x and the regular integers on separate sides of the equals sign, so you divide the -4.6 to get the x on its own side of the equals sign. That's the first step to solving the equation.


Plot each point on the coordinate plane.


Answers

A left 3 time up 5 times.
B right 2 times down 4 times.
C start at the center then go up 3 times.
D just go to the right six times.
E left two times and down 7 times

I hoped that helped.

Ray earns $15 an hour for up to 40 hours a week. If he works more than 40 hours a week, he is paid time and a half. That means Ray is paid 150% of his hourly wage for every hour he works over his normal 40 hour work week. How much would Ray's paycheck be if he works 46 hours in one week?

Answers

Answer:

$735

Step-by-step explanation:

40 hours x $15 per hour = $600

6 hours x $22.50 = $135

Add both dollar amounts together

Can someone please help me with this question i have 3 minutes left

Answers

Answer:

It will cost 11 cents a day.

Step-by-step explanation:

1.98/18=11

plzz have brainiest

Before your trip to the mountains your gas tank was 7/9 full. When you returned home, the gas gauge registered 1/3 of a tank. If your gas tank holds 18 gallons did you use to drive to the mountains and then back home?

Answers

That means it would be 20/17

Explain what needs to be fixed.
2n + 10 = -2
2n = 12 Step one
n = 6 Step two

Answers

Answer:

step one needs to be fixed... you are supposed to subtract 10 from both sides of the equation.

Step-by-step explanation:

STEP 1: Move all terms not containing n to the right side of the equation.

[tex]2n=-12[/tex]

STEP 2: Divide each term by 2 and simplify.

[tex]n=-6[/tex]

Need help with geometry.

Answers

Answer:

42

Step-by-step explanation:

Dalia used a balancing move to begin to solve the
equation below.
6x + 12 = 10x - 4
The result of Dalia's first step was 12 = 4x – 4.
Describe the first step Dalia made to solve the equation.

Answers

To combine like terms and single out one term to take it easier to solve, the 6x was moved to the other side to combine like terms.
Subtracting 6x from 10x which is 4x

Can someone help me please

Answers

Answer:

64 cm^2

Step-by-step explanation:

SA = s^2 + 2sl

= 4^2 + 2(4)(6)

= 64 cm^2

Other Questions
Which element is probably most like Carbon? and why Examine the map of major North American cities. A map titled Major Cities in North America with labels A, B, C, and D. Canada, the United states, and Mexico are labeled. A is near Washington and Canada. B is near the Pennsylvania and New York. C is in southern California. D is in Mexico. Which city is located at C? Vancouver Los Angeles Guadalajara Washington, DC I really need someone to explain the 6 stages of mitosis GIVING BRAINLIEST!!!What were the major issues that prisoners faced in Andersonville prison? Select all that apply. (2 points)A. Water was scarce and polluted.B. Food supplies were inadequate so prisoners starved.C. Prisoners rebelled and staged an uprising.D Prison overcrowding forced prisoners to be freed early. What is the product of 417.2 x 0.64? Helppppppppppppppppppppppppppppppppp!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! what do you mean by community based medical profession simplify by combining like terms: 3 1/9p + 5 - 1/3p Sherly's Plumbing and Howard's Plumbing have differentways of charging their customers.Sherly's Plumbing charges $43 per hour plus a $30 initialfee.Howard's Plumbing charges $28 per hour plus a $24initial fee.Make a function that represents each person, then findthe cost, f(7), for each person.Your answer: Not there yet, keep workingQuestionAnswerLinear Function for Sherly:s =Linear Function for Howard:Sherly $(7) =Howard $(7) = How would adding the catalyst nitrogen monoxide (NO) affect this reaction?2SO2(g) + O2(g) 2SO3(g)A) NO increases the rate at which SO3 molecules are formed.B) NO reacts with SO3 to produce more SO2 molecules.C) NO decreases collisions between the SO2 and O2 molecules.D) NO increases the concentration of the SO2 and O2 molecules.E) NO increases the activation energy of the SO2 and O2 molecules. thanks guys i only got one question wrong i cant find my answer. You should really give your people the answer they are looking fo instead of giving sujestions. Write the slope-intercept equation for the graph. Energy that is stored is called... Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC If a girl is standing still and holding a box, is she doing any work? (No)The _____ on the box is not in the same _____ as the movement 9x + 6 4x 1x + 1 10 machine A covers 5/8 square feet in 1/4 hour or machine B covers 2/3 square feet in 1/5 hour What is the function of the flower in plant reproduction? disperses seeds captures sunlight protects the stem attracts pollinators write a letter to your friend describing him/her about your country nepalGuys plz help me with this question write a letter about nepal. If u guys help me with this question i will make you brainliest and give 25 points. But its so urgent so plz do it fast.