p(x+1)=5x+1, find p(x)​

Answers

Answer 1

Answer:

p(x) = 5·x - 4

Explanation:

The given function is p(x + 1) = 5·x + 1

Therefore, the function takes a variable, x + 1 and gives the a result of 1 added to 5 times 1 less the variable x + 1 as follows;

p(x + 1) = 5 × ((x + 1) - 1) + 1

Therefore, the vale of the function p(x) is given as follows;

p(x) = 5 × ((x) - 1) + 1 = 5·x - 5 + 1 = 5·x - 4

p(x) = 5·x - 4


Related Questions

Describe how the rotation of Earth around its own axis and its revolution around the sun affect sunrise and sunset. Explain why will this be different from outer space.

Answers

Answer:

since earth rotates on a tilted axis we experience night and day, and also different seasons. while being tilted on our axis we can experience longer days and shorter night when pointing towards the sun (summer), and shorter days and longer night pointing away from the sun (winter). you would experience a difference in space because you wouldn't be rotating on a axis any more. you would experience the same night and day patterns every day.

Explanation:

hope this helps!

the Earth's most important non-renewable energy resource is
A) coal
B) oil
C) natural gas
D) the Sun​

Answers

Answer:

The Earth's most important non-renewable energy resource is Fossil fuels, which include coal, oil, and natural gas.

If you search up your question on Brainly, both choices A) Coal and C) natural gas got bad votes. So that leaves us with B) Oil.

I hope this helps somehow. :>

anyone live in davison michigan

Answers

i did for the longest. i moved last month…

Answer:

nope

im on the west coast far away from michigan

Which statement describes the Milky Way galaxy and Earth's position in it?
A. It has a central core surrounded by a spherical halo of stars, and
Earth is inside the core.
B. It has a central core surrounded by a spherical halo of stars, and
Earth is in the halo.
O C. It has a central core around which its spiral arms spin, and Earth is
in one of those arms.
D. It has a central core around which its spiral arms spin, and Earth is
inside the core.

Answers

Answer:

it has a central core surrounded by a spherical halo of stars and Earth

is inside the core

What causes global convection currents to form?
O A. Unequal heating of Earth's surface
B. Differences in elevation on Earth
C. Earth's local winds
D. Earth's spin

Answers

The answer would be A unequal heating of the earths surface. Lighter dense warm material rises as heavier dense cool material sinks causing differential heating.

¿Qué dificultades y ventajas presentaban las características geográficas de la cuenca del Mediterráneo para la agricultura, las comunicaciones y el transporte, la vida cotidiana?

Answers

Answer:

Dificultades para agricultura:

Eventos de sequía muy marcadaPlagas y pestesSobredemanda

Ventajas para agricultura:

gran proporción de especies nativas con alto valor energético y potencial de domesticaciónclima costero templado

Ventajas para comunicaciones y el transporte

Mar mediterráneo uniendo pueblosDesarrollo de la navegaciónAsentamientos en las zonas costerasIncremento de la comercialización e intercambio de productos y saberes

Explanation:

En el área mediterranea existe una alta proporción de especies nativas con potencial de domesticación, entre las que se encuentran muchos pastos y mamíferos. De hecho, muchas de las especies cultivadas y comercializadas a nivel global en la actualidad provienen de pastos del mediterraneo.

En el clima mediterráneo, la estacionalidad es muy marcada en las caras oeste de los  continentes. La estación seca ocurre durante el verano, y la estación húmeda ocurre durante el invierno.

En invierno, la tierra tiende a  enfriarse más que el agua del océano, y los vientos del oeste traen a la costa aire cargado de  humedad, que se condensan, y precipitan. En verano,  la tierra está más caliente que el océano; los vientos del oeste soplan tierra  adentro y se calientan en tierra,  absorbiendo más humedad, y haciendo más secas las condiciones en tierra.

La estación seca es hostil debido a las elevadas temperaturas  del verano. Los eventos de sequias, junto a la mayor tendencia de ocurrencia de plagas que ataquen los cultivos, sumada a la sobredemanda, hacen de la agricultura una actividad dificil.  

Aún así, fue el clima costero templado el que favoreció el desarrollo de la agricultura. La producción de trigo, vino o aceite de oliva, entre otros productos de alto valor energético, generaron un gran impacto económico, incrementando el comercio y la comunicación dentro de la zona mediterránea.

La tendencia de los pueblos a ubicarse cerca del agua distó mucho de ser una limitación. Desarrollaron la navegación a través de la que pudieron incrementar el comercio e intercambio cultural entre pueblos. Sumado a ello, este tipo de transporte facilitó la colonización de nuevas áreas.

En la cuenca del Mediterraneo se encuentra la Medialuna Fertil, que porbablemnte haya sido el primer centro de domesticación. Es aquí donde comenzaron la domesticación de distintas especies vegetales y de algunas especies animales.  

Which of the following is an environmental challenge facing the Sahel?
a. desertification
c. shifting agriculture
b. deforestation
d. all of the above

Answers

Answer:

pretty sure it's d not sure also might be b but I think it's d

Answer: deforestation

Explanation:

The foreign minister of Zeria announced today that her country was severing diplomatic relations with Nandalo because of Nandalo's flagrant violations of human rights. But Zeria continues to maintain diplomatic relations with many countries that the minister knows to have far worse human-rights records than Nandalo does. Therefore, despite the foreign minister's claim, this latest diplomatic move cannot be explained exclusively by Zeria's commitment to upholding human rights.

Which one of the following, if true, provides the most support for the argument in the passage?
A) The country that currently buys most of Zeria's exports recently suggested that it might severely restrict its imports from Zeria unless Zeria broke off diplomatic relations with Nandalo.
B) Two weeks after the Zerian minister's announcement, several other countries cited human-rights violations as a reason for severing diplomatic relations with Nandalo.
C) More countries have expressed concern over reported human-rights violations in Nandalo than have expressed concern over human-rights violations in Zeria.
D) Nandalo has considered accusing Zeria of violating the human rights of Nandalo citizens living in Zeria.
E) The opposition party in Zeia has long advocated severing trade relations with countries that systematically violate human rights but has opposed severing diplomatic relations.

Answers

Answer: A) The country that currently buys most of Zeria's exports recently suggested that it might severely restrict its imports from Zeria unless Zeria broke off diplomatic relations with Nandalo.

Explanation:

When countries a lot of the times, there is usually an ulterior motive to it and this often comes down to money. In this case, keeping relations with Nandalo must have somehow threatened the money supply to Zeria and so Zeria had to take action against this.

Option A provides a plausible reason as to why this could be the case. If a country that buys a lot of Zeria's exports threatens to stop buying from Zeria, they would be inclined to act in a way that the country wants in order for the country to keep buying those exports and if that includes breaking off relations with Nandalo then it will be done.

¿Por qué la mayoría de la población colombiana vive en las zonas montañosas?​

Answers

respuesta:

porque hay zonas templadas la mayoría de la población reside en zonas inferiores a 500 metros, donde las temperaturas, el relieve, y la fertilidad de los suelos son más propicios para la vida humana que las montañas.  

Explanation:

Hhhhhheeeeellllpppppppppppp

Answers

I believe the answer is -5+6=1

List 4 of the 8 Millennium Development Goals. Then explain
why they are important to quality of life. Write your answer
on a separate sheet of paper. (8 marks)

Answers

Answer:

The correct answer is - all 8 goals are given below select any four.

1. Eradicate extreme poverty and hunger

2. Achieve universal primary education

3. Promote gender equality and empower women

4. Reduce child mortality

5. Improve maternal health

6. Combat HIV/AIDS, malaria, and other diseases

7. Ensure environmental sustainability

8. Develop a global partnership for the development

Explanation:

The Millennium Development Goals are made by the UN and accepted by all the nations of the UN to achieve these goals in time. All these goals are made to improve the quality of life all over the globe by removing poverty, hunger.

Education for all the people which helps in awareness better chances of a job. Improving health, decreasing child mortality, and fighting lethal diseases such as HIV, malaria, and many more.

What do u mean by natural vegetation ?​

Answers

Answer:

Natural vegetation refers to a plant community, which has grown naturally without human aid and has been left undisturbed by humans for a long time. This is termed as a virgin vegetation. Thus, cultivated crops and fruits, orchards form part of vegetation but not natural vegetation.

For Example:

The grasses, shurbs and trees that grow on their own without any human interference or help are termed natural vegetation.

The amount of water on Earth
A: decreases slightly over time and does not change form.
B: remains the same and does not change form.
C: increases slightly over time, but changes forms.
D: remains the same, just in different forms.

Answers

D

it remains same, just in different forms

It’s d trust me bro I know

Please Help Label the diagram

Answers

Answer:

you already labelled it correct

Can someone help me out?

Answers

Answer:

c

Explanation:

The answer is c girl hhhhh

what is the difinition of wind?by explanation.​

Answers

Answer:

Wind is the perceptible natural movement of the air, especially in the form of a current of air blowing from a particular direction.

Match each philosophy to the correct philosopher

Answers

Answer:  

maintained that religion... - Voltaire

maintained that each... - Jean Jacques Rousseau

believed that people... - Thomas Hobbs

believed that natural law... - William Blackstone

Explanation: Plato Answers :)

Like and Rank me Brainliest

¿Cuál continente concentra más industria pesada • ¿Cómo es la distribución de la industria ligera en el mundo? • ¿Dónde se concentra la industria pesada en el continente americano? • ¿Qué tipos de industria se localizan en nuestro país?

Answers

Answer: El continente que más concentra la industria pesada es Europa, pero también destaca Estados Unidos en América, y China y Japón en Asia.

La distribución de la industria ligera en el mundo se caracteriza por su bajo consumo energético, su fácil integración y por la producción de una escala intermedia an alta.

Las áreas de desarrollo mechanical pesado se encuentran localizadas en su mayoría en el centro del país. Comprenden la parte focal del Estado de México, Nuevo León, Coahuila, centro de Guanajuato, centro de Veracruz, centro de Jalisco, la Comarca Lagunera (entre Coahuila y Durango) y la ciudad de Mérida en Yucatán.

Tenemos que la industria que se localizan en nuestro país (México), child principalmente: industria pesada, pesquera, metalúrgica, textil, farmacéutica, eléctrica , azucarera , manufacturera y agrícola, siendo estas las más relevantes.

Explanation:

the difference in the demands on the governments of these different groups​

Answers

Answer:

Due to different problems.

Explanation:

There are difference in the demands on the governments of these different groups​ because different groups have different problems. For the fulfillment of these demands they come out for demonstrations and end their strike when the government fulfill their demands otherwise they will not go from this place. If the demands of the groups are right so this is the responsibility of government to fulfill their demands.

Determine the value of X in the figure.

A: 4/3

B: 4

C: -4

D: 8

Answers

The answer is B.
This is because the triangle is an isosceles triangle, meaning that the answer to 4x-8 = x+4
You can rearrange this question to put the x’s on both sides and the integers on both sides so that 4x-x = 4 + 8. This cancels down to 3x = 12. To find x, divide 12 by 3, which is 4.
To check this answer, you can input 4 into both of the equations. (4 x 4) - 8 = 8, and 4 + 4 is also 8. Hence, you know x = 4.

Another, more time-consuming way of doing this question would be to simply input each possible value (A, B, C and D) into both equations until the both equations came out with the same number.
Hope this helped :)

People who practice ______
read the Torah for guidance.
A: Hinduism
B: Christianity
C: Islam
D: Judaism

Answers

The answer is

D. Judaism
The answer is

D. Judaism

what are two characteristics of the CBD​

Answers

Answer:

Some of the key characteristics of CBDs include:

High concentration of offices, banks, financial institutions, and so on.

High density and high-rise buildings.

High land values.

Lack of open and/or green space.

Department stores and high-end shops.

Multi-storey car parks.

Explanation:

plz mark me as brainlist

hope it HELPS..!!

ANSWER:

three characterstics of the cbd:

1. High land values.

2.Lack of open OR green space.

3. High density and high rise buildings.

THANK YOU

1569 cu. cm=_________cu.m​

Answers

Y’all still have school?

Which practice of citizenship most often results from strong feelings of nationalism or patriotism?

A)Organizing an antigovernment march
B)Enlisting to serve in the military
C)Voting in local elections
D)Serving on a jury

Answers

Answer:

Enlisting to serve in the military.

the answer you need is B. Enlisted to serve in the military

There are similar mountain
ranges that match up with each
other on continents that are now
oceans apart.This is evidence of
which of the following?
A. that these mountain ranges were formed after
Pangea split
B. that all mountains on Earth are the same
C. that these were once one mountain range on
Pangea
D. that mountain ranges are not evidence of
Pangea

Answers

Answer: C

Explanation: If all the mountains are incredibly similar despite the difference in location and general environment, it stands to reason that they were very likely part of the same range before Pangea split.

There are similar mountain ranges that match up with each other on continents that are now oceans apart. This is evidence that there was once one mountain range on Pangea. The correct option is c.

Pangea was ripped apart for the first time when a three-pronged fissure formed between Africa, South America, and North America. Rifting started when magma welled up through a crack in the crust, forming a volcanic rift zone.

According to plate tectonics theory, there were mountain ranges that are similar on the continent which are now separated by the oceans and this proves that there were mountain ranges on Pangea.

Thus, the evidence says that there was once one mountain range on Pangea.

Learn more about Pangea, here:

https://brainly.com/question/34078418

#SPJ5

which of the following did the united states build for central america.

1 Panama canal
2 Yucatan peninsula
3 Gulf of Mexico

Answers

Answer:

Pretty sure the answer is Panama Canal

Explanation:

We share this as 2 countries and it makes life easier for both sides. Also, the Gulf of Mexico is a shoreline.

why study the Caribbean sea?​

Answers

Answer:

The sea is literally the lifeblood of their economies, supporting the transportation of goods and people through shipping, providing food from fisheries and underpinning the most important economic activity in the region: tourism

how does latitude of a location impact the weather and climate?

Answers

Answer:

There is a relationship between latitude and temperature around the world, as temperatures are typically warmer approaching the Equator and cooler approaching the Poles. There are variations, though, as other factors such as elevation, ocean currents, and precipitation affect climate patterns.

Explanation:

Answer:

There is a relationship between latitude and temperature around the world, as temperatures are typically warmer approaching the Equator and cooler approaching the Poles. There are variations, though, as other factors such as elevation, ocean currents, and precipitation affect climate patterns. The most important factor is latitude because different latitudes receive different amounts of solar radiation. Sunlight filters through a thick wedge of atmosphere, making the sunlight much less intense.

Explanation:

The absolute location of Lincoln Nebraska is

Answers

Answer:

The absolute location of Lincoln Nebraska is Southeastern Nebraska, south of the Platte River.

Explanation:

40.8136° N, 96.7026° W is the absolute location of Lincoln Nebraska.

What is the main cause of global warming

Answers

Answer:

It is caused by increased concentrations of greenhouse gases in the atmosphere, this is driven by human activities including the burning of fossil fuels, and farming.

Answer:

It is cuased by the ice melting... I think

Other Questions
Translate and solve: twenty-three greater than b is at least 276. Solve the inequality.1x+5 < 62Help me please Please help! I dont understand how to solve it with no angle Qu funcin cumple la poltica en los conflictos sociales Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read 1.Name the canan that connects the Red sea to the Mediterranean Sea2.Name the country where coffee was discovered3.Name the system of racial segregation seen in South Africa4What is the term given to the peninsula that forms the easternmost projection of the African continent5Name the precious gem that is the major natural resource of Africa6Name the Savannah region that is the site of the largest mammal migration on Earth A digital signal differs from an analog signal because it a.consists of a current that changes smoothly. b. consists of a current that changes in pulses. c.carries information. d. is used in electronic devices. Write an equation for the line that is parallel to the given line and that passes through the given point. y = 1/2x - 8; (-6, -17). Find the equation of the line that passes through the points A (2, 3) and B (5, -7) how did advancements in technologry help bring a quick end to conflict in the pacific during world war II My School in vanacola In what way was the Third Reich most successful?Strikes only occasionally affected production of goods.Factories and the infrastructure were expanded.The media enthusiastically supported the work of the ruling party.The workplace was open to many individuals. Consider the functionsf(x) = xn and g(x) = xmon the interval [0, 1], where m and n are positive integers and n > m. Find the centroid of the region bounded by f and g. Write 8 as a percentage of 32Plssss helppp A senator introduces a bill by taking it to the president pro tempore, the majority leader, and the minority leader.TrueFalse****If a bill cannot be voted on due to the lack of members present, it is unlikely that the bill will make it to the House floor.True***False por qu se termina el bombardeo de Hiroshima y nagasaki Explain how the slow recovery of the bald eagle population likely affected the recovery of the salmon population Last month, the Tecumseh Corporation supplied 400 units of three-ring binders at $6 per unit. This month, the company supplied the same quantity of binders at $4 per unit. Based on this evidence, Tecumseh has experienced:_________.a. a decrease in supplyb. an increase in supplyc. an increase in the quantity suppliedd. a decrease in the quantity supplied. the average of three numbers is 25. two of the numbers are 18 and 40. what is the third number James Polk believed in which of the following ideas?A) The United States should not expand west of the Mississippi River.B) The United States should negotiate with native tribes in the western territories in order to acquire land.C) The United States should extend from the Atlantic Ocean to the Pacific Ocean.D) The United States should acquire land only through peaceful compromise.