punnet squares are a useful tool in genetic studies. Which of the following describes the most likely use of this tool?
a. To quantify proportions of offspring with polygenetic traits
b. To determine the genotypic ratios of crosses
c. To determine frequencies of recombination
d. to measure phenotypic variability

Answers

Answer 1

Answer:

B

Explanation:

To determine the genotypic ratios of crosses


Related Questions

why do solids have a fixed shape

Answers

Answer: solids have fixed shape because they are rigid and is high dense. The particles are way too close to each other that even force applied to it doesn’t change it shape

explain the gaseous exchange in lungs

Answers

Answer:

Gas exchange is the delivery of oxygen from the lungs to the bloodstream, and the elimination of carbon dioxide from the bloodstream to the lungs. It occurs in the lungs between the alveoli and a network of tiny blood vessels called capillaries, which are located in the walls of the alveoli.

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

Answer:

breathing allows the exchange between 2 gases: oxygen and carbon dioxide. Gas exchange occurs in millions of lung alveoli and the capillaries that surround them

Explanation:

Use this list of technical steps for the following question: 1. Two cells were fused using a small electrical current. 2. An embryo was implanted into a "surrogate mother". 3. All nuclear DNA was removed from a sperm. 4. A cell was taken from an adult sheep. 5. All nuclear DNA was removed from an egg. What is the order of events in producing a cloned animal

Answers

Answer:

The correct order of events would be - 4, 5, 1 and 2.

Explanation:

In the process of producing the cloned there are various steps are involved. Carrying out these steps in order is essential to produce the cloned animal. These steps are in correct order are given as follows-

4. A cell was taken from an adult sheep or the animal that is desired to be cloned.

5. All nuclear DNA was removed from an egg of the sheep.

1. two distinct cells of the animal were fused together with the help of electrical current.

2. the embryo formed by fusing the cells now implanted into a surrogate mother.

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

what are some non examples of hydroshere

Answers

Oceans, lakes, seas, and clouds are examples.

The hydrosphere is made up of all the water on the planet, including the water found below the surface and in the atmosphere. A planet's hydrosphere may be liquid, vaporous, or composed of ice. The three surface water bodies on Earth are oceans, lakes, and rivers.

What are some non examples of hydrosphere?

It comprises all surface waters that are liquid or frozen, groundwater that is contained in soil or rock, and atmospheric water vapor. The hydrologic cycle continuously circulates almost all of these waters. In wells and aquifers, it can also be found underground as groundwater.

Within the hydrosphere, water circulates in a cycle. Clouds contain water that eventually falls to Earth as rain or snow.

Therefore, Rivers, lakes, and seas are where this water gathers. The cycle is then restarted by its evaporation into the atmosphere. The water cycle refers to this.

Learn more about hydrosphere here:

https://brainly.com/question/14686427

#SPJ2

The narrative point of view in this excerpt allows the
reader to experience
O Rainsford's feelings as he enters the room.
Rainsford's feelings about his host.
Rainsford's impression of the dining room.
O Rainsford's impression of the island.

Answers

Answer:

O Rainsford's impression of the dining room.

Explanation:

Richard Connell's short story "The Most Dangerous Game" revolves around the famed hunter Sanger Rainsford and his change of fortune when he was left stranded in an island famed for hunting humans as a game by the island's barbaric owner General Zaroff.

In the given excerpt, the narrator reveals the "dining room to which Ivan conducted (Rainsford)". The impression that the hall was "of feudal times with its oaken panels, its high ceiling, its vast refectory table where twoscore men could sit down to eat" reveals the outline of the enormous dining hall where Rainsford was conducted to eat with Zaroff. This narrative point of view allows the reader to experience the impression of the dining room.

Answer:

C

Explanation:I took the quick on Ed (:

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

True or False: Polar molecules do not have a difference in electrical charge.

Answers

Answer:

false

Explanation:

nonpolar molecule has no separation of charge, so no positive or negative poles are formed

Shivering and vasoconstriction would be signaled to cause a: A. increase in pH. B. decrease in temperature. C. decrease in pH. D. increase in temperature.

Answers

Answer:D

Explanation: shivering occurs when someone is cold and vasoconstriction is when the blood vessels close to the skin and the veins closer to the skin surface constrict as a result of dat air doesn’t enter the body

Vasoconstriction is the narrowing of the blood vessels that hinders blood flow. Vasoconstriction and shivering will lead to an increase in the temperature through thermoregulation. Thus, option d is correct.

What is thermoregulation?

Thermoregulation is the maintenance and balancing of the temperature and heat in the body. They are regulated by many factors including shivering and vasoconstriction.

During the vasoconstriction, the blood vessels close to the skin surface close and the body shivers as a result of cold or decreased temperature. This signals the body to increase the temperature so that shivering can be stopped.

Therefore, vasoconstriction and shivering signal the body to increase the temperature.

Learn more about thermoregulation here:

https://brainly.com/question/7450241

#SPJ2

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

what is the SI unit of focal length
,​

Answers

Answer:

dioptre is si unit of focal length

where 1 dioptre = 1 m^-1

do foxes hunt alone yes or no.

Answers

yes. but occasionally they meet up with their packs during the night

Answer:

yes they hardley ever travel in packs

any 3 communicable diseases,its symptoms,prevention and source.

Answers

Answer:

1) Flu

2) Hantavirus

3)HIV/AIDS

hope it helps you

Explanation:

a) dry apricots are left transferred to sugar solution?

Answers

When dry apricots are left for sometime in pure water, they will swell. Because, water will enter into them through the process of osmosis. Later,when these apricots will be transferred to sugar solution, they will again shrink.

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

what is the defination of matter?​

Answers

Answer:

matter is a kind of substance

Answer:

any thing that has a mass and occupies space is called matter

Explanation:

for example

a book is a matter because it has a mass and it also occupies some space

2. What happens in
terms of energy
when you hold a
craft stick and bend
it slightly?

Answers

Answer:

In a similar way a wooden tongue-depressor stick (like the kind used at the doctor's office) stores elastic potential energy when you bend it (though not if you break it). ... The elastic potential energy that was stored in the stick is transformed into movement, called kinetic energy.

Explanation:

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

Natural selection can, through common descent, produce closely related species that have similarities due to their shared ancestry. Natural selection can also, through convergent evolution, lead to distantly related species appearing very similar. Identify which examples reflect common descent and which reflect convergence.

Answers

Complete Question:

Natural selection can, through common descent, produce closely related species that have similarities due to their shared ancestry. Natural selection can also, through convergent evolution, lead to distantly related species appearing very similar. Identify which examples reflect common descent and which reflect convergence.      

Tree-dwelling primates have prehensile tails for gripping branches. Tree-dwelling opossums also have prehensile tails.  Many birds and some kinds of bats that feed on plant nectar all have long flexible tongues.    Primates use opposable thumbs to help climb. New World monkeys also have prehensile tails, but Old World monkeys do not.  Marsupial mammals throughout Australia show a wide diversity of forms that reflect the habitats in which they live. Hawaiian honeycreepers, with their elongated, nectar-sipping bills, all evolved from a finch-like ancestor.

Answer and Explanation:

Tree-dwelling primates have prehensile tails for gripping branches.  Considering recent ancestors, the prehensile tail trait can be considered as a convergence example that occurred among different groups. But we can also think about it as a common descent if we consider the farthest primates ancestor. Although still controversial, Plesidiapsi might be considered a common ancestor of primates, that evolved from a ree-dwelling mammal with a long tail. It is believed that this animal used to live in trees.   Tree-dwelling opossums also have prehensile tails.   Convergence. Many birds and some kinds of bats that feed on plant nectar all have long flexible tongues. Convergence. These are two groups that are very separated from each other, and they developed different traits according to their needs separately. Some of the species of these two groups adapted to feed on the same plant so they needed to develop the same characteristic to obtain nectar.Primates use opposable thumbs to help climb. New World monkeys also have prehensile tails, but Old World monkeys do not.   Common descent . The common ancestor had a prehensile tail, some of the descendants developed the tail but some others did not.Marsupial mammals throughout Australia show a wide diversity of forms that reflect the habitats in which they live.  Common descent . Hawaiian honeycreepers, with their elongated, nectar-sipping bills, all evolved from a finch-like ancestor.  Common descent . They all look like the finch-like ancestor.

In which form do plants store energy?
starch
glycogen
chitin
cellulose

Answers

Answer:

starch

Explanation:

plant store energy in the form of starch and animal store energy in the form of  glycogen these starch and glycogen are converted into glucose whenever body needs energy

Answer:

The answer is Starch

Explanation:

Hopefully this helps you

pls mark brainlest

It is right on Edge2020

marasmus is caused due to diet insufficient in (a) proteins (b) carbohydrates (c) fats (d) all of these

Answers

The Appropriate answer:

[tex] \large{ \boxed{ \bf{ \color{red}{Carbohydrates(B)}}}}[/tex]

Explanation:-Bread and cereal group includes food made from grains auch as rice, wheat and corn. They are rich in carbohydrates and theh give energy to our body to work and play.Our body needs certain nutritional needs, and jf they aren't fulfilled, then chances of deficiency diseases increases. Deficiency of Carbohydrates causes Marasmus. The body losses activeness, bodyaches are frequent.

Explore more:-Carbohydrates are made up of three elements: Carbon, Hydrogen and oxygen.There are simple or complex polysaccharides which also determines the simplicity of carbohydrates.

━━━━━━━━━━━━━━━━━━━━

Use the image to answer the question below: Using the model presented, what process is being depicted? A) An electrical signal being converted to a chemical signal B) Salutatory conduction C) The transfer of neurotransmitters between axons D) The path of a steroid hormone

Answers

Answer:

option A is correct because of it is undergoing a convertion

Which structure is located between the trachea and a bronchiole? A. epiglottis B. pharynx C. alveolus D. bronchus

Answers

the correct answer is the bronchus

Which of the following items was Darwin able to use to study the structures of
extinct organisms?
A. Fossils
O B. Species
O C. Amino acids
O D. Adaptations

Answers

Answer:

a

Explanation:

because that is all he had left of extinct animal's.

Answer:

A

Explanation:ithink not sure

Drag each label to the correct location. Classify the interactions as being direct or indirect competition. Two eagles fight over a salmon carcass. All the gray foxes in a habitat prey primarily on penguins. Two colonies of black ants clash over a wasp. Gray squirrels in an area rely on nuts for food.

Answers

Answer:

Two eagles fight over a salmon carcass- DIRECT

All the gray foxes in a habitat prey primarily on penguins- INDIRECT

Two colonies of black ants clash over a wasp- DIRECT

Gray squirrels in an area rely on nuts for food- INDIRECT

Explanation:

Living organisms of same or different species tend to interact with one another in their natural habitat. One of those interactions is competition, which occurs when living organisms share the same limited resources or occupy the same niche in their habitat.

However, competitive interaction between organisms can either be direct or indirect. Direct interaction is that which involves a physical interaction between the organisms i.e. a confrontation. A struggling for the limited resource is evident. For example, two eagles fighting over a salmon carcass and two colonies of black ants clashing over a wasp shows the form of physical confrontation for the limited resource between the organisms involved. Hence, they are examples of direct competition.

On the other hand, indirect competition involves the competition for a limited resource without a physical confrontation or struggle. Organisms make use of the limited resource until it becomes unavailable to competitors. For example, gray foxes in a habitat that prey primarily on penguins and gray squirrels in an area relying on nuts for food shows a competition for a scarce resource without any physical interaction between them. Hence, they are examples of indirect competition.

If a force of 90 N is applied to each cart, which cart has the greatest
acceleration? *
1 point​

Answers

Answer: Cart 1 would have the greatest acceleration. It weights less and if you apply force it will go faster than other carts.

Explanation:

(at least so I think, don't shame me if I am wrong)

Other Questions
Zach keeps his pet chameleon Pinky in a terrarium with the dimensions shown below. There's sand in the bottom of the terrarium that reaches a height of 888 centimeters. Zach gets a new terrarium for Pinky that is larger. The base of the new terrarium is 252525 by 646464 centimeters. Zach moved the existing sand to the new terrarium. How deep will the sand be in the new terrarium? Who was the first Postmaster General?A. George WashingtonB. George WashingtonC. Benjamin FranklinD. Washington CarverIt is C. Benjamin Franklin Which statement best explains why the sine of an acute angle is equal to the cosine of the angles complement Explain how the contributions of Ivan Pavlov, John B. watson, and B.F. skinner redefined psychology under the banner of observable behavior? Consider that President Roosevelt delivered the Four Freedoms speech on January 6, 1941. What is the historical context of this speech in relation to World War II A certain pole has a cylinder-like shape, where the base's radius is 10 centimeters and the height is 2 meters. What calculation will give us the estimated surface area of the pole in square centimeters? What is true about a scale (Music) Which provides long-term energy storage? Answer two questions about Equations A and B: A.5x=20 \ B.x=4 1) How can we get Equation B from Equation A? Choose 1 answer: (Choice A) Multiply/divide both sides by the same non-zero constant (Choice B,) Multiply/divide both sides by the same variable expression (Choice C) Add/subtract the same quantity to/from both sides (Choice D) Add/subtract a quantity to/from only one side In this diagram, bac~edf. if the area of bac= 6 in., what is the area of edf? PLZ HELP PLZ PLZ PLZ PLZ Bob cycles 5.4 km every morning.how many feet are in 5.4 km, given that 1 mile=1.609 km and 1 mile=5,280 feet? How much would you have to deposit today if you wanted to have $60,000 in four years? Annual interest rate is 9%. (PV of $1, FV of $1, PVA of $1, and FVA of $1) (Use appropriate factor(s) from the tables provided.) b. Assume that you are saving up for a trip around the world when you graduate in two years. If you can earn 8% on your investments, how much would you have to deposit today to have $15,000 when you graduate? (Round your answer to 2 decimal places.) Which is a category for mental health disorders determine if the following side lengths create an acute,obtuse,or right triangle. a) 20, 21, 28 b) 3, 6, 4 c) 8, 12, 15 12 people can paint the orchard in one hour How long would it take five people Give your answer in minutes For a given confidence level, t ? df is larger than z ? . Explain how t df being slightly larger than z affects the width of the confidence interval. Why do roosters hibernate? In a widely publicized dispute, William O'Hara refused to sell his land in Willamette County to the local school board. O'Hara believed that the price the school board offered for the land was not sufficient. If the school board wanted to pursue the matter in court, what proceeding would it institute to attempt to force O'Hara to sell the land? The statement "Automobiles manufactured by this brand are the safest" is an example of the _____ component of attitude. The length of country & western songs has mean 151 seconds and standard deviation 30 seconds. Determine the probability (as percent) that a random selection of 20 songs will have mean length of less than 149.75 seconds.