Please I need help with this

Please I Need Help With This

Answers

Answer 1
TAAGCCGATAAATGCTAACGGTA

Related Questions

Based on fossilized evidence, there are scientific claims made about the evolution of certain species. If a scientist studying the fossils of a specific species had a hypothesis other than what was currently accepted, what steps should be taken to have the alternative hypothesis considered

Answers

Answer: For the scientist to have alternative hypothesis considered, it is imperative he takes certain steps, this steps will ascertain the scientific claims already made about the evolution of species.

Therefore,the scientist will simply test the alternative hypotheses inorder to know that they are incorrect.

This testing of hypotheses to ascertain their incorrectness is very useful in the study of fossils.

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

What has a greater influence on protein levels? A. Protein degradation has a greater influence because they are denatured faster than the cell can produce them B. mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced C. mRNA destroyer concentration has a greater influence because mRNA is destroyed right after the proteins are produced D. Protein degradation has a greater influence because outside factors like antibiotics can cause it, and it is difficult to recover from

Answers

Answer: b

Explanation: i got the answer wrong and i’m looking at the results rn

Protein is being produced with the help of a process called translation in which mRNA gets translated to produce proteins. The translation is followed after the process of transcription of DNA to RNA.

The cause of the greater influence of protein levels has defined as follows:

The destruction of mRNA could greatly influence protein levels as mRNA is considered the source for proteins to get synthesized. This is because if mRNA gets destroyed, proteins would not have been produced at all. Thus, directly influences the levels of protein.

Thus, we can conclude that mRNA destroyer concentration has a greater influence because it is destroying mRNA before proteins can even be produced. Hence, option (b) is the correct answer.

Learn more about protein here:

https://brainly.com/question/22241855

What do nitrifying bacteria do?

Answers

Answer: Nitrifying bacteria such as Nitrosomonas play an important role in providing nitrogen to plants and limiting carbon dioxide fixation. They are found widely distributed in soil or water, where there are large amounts of ammonia, such as lakes or streams into which treated and untreated sewage is pumped.

Explanation:

Answer:

They change Nitrogen to Nitrite and ammonia. Which helps plants to use Nitrogen even though it's in another form.

Hope this helps ;) ❤❤❤

If you are preparing a report about the effect of climate change on sea level,
whose work would you be most likely to study?
A. Warren Washington
B. Edwin Hubble
O C. Christian Doppler
O D. Charles Kuen Kao

Answers

A. Warren Washington

Answer:

A. Warren Washington

I hope this helps you :)

18. Pepsin is an enzyme produced by stomach cells
to help digest protein. Stomach cells package
and secrete pepsin in which of the organelles

Answers

Answer:

Golgi bodies /apparatus

Explanation:

this organelles are responsible in for packaging and transportation of glyco proteins therefore are the organelles mainly involved in secretion of synthesised proteins

Pepsin is an enzyme produced by stomach cells to help digest protein. Stomach cells package and secrete pepsin Golgi bodies.

What are Golgi bodies?

The majority of eukaryotic cells contain the Golgi apparatus, sometimes referred to as the Golgi complex, Golgi body, or just the Golgi.

It packs proteins into membrane-bound vesicles inside the cell before the vesicles are delivered to their destination. It is a component of the endomembrane system in the cytoplasm.

It is situated close to the cell nucleus and the endoplasmic reticulum in the cytoplasm.

Pepsin is an enzyme that the stomach cells manufacture to aid in the breakdown of protein. Pepsin Golgi bodies are packaged and secreted by stomach cells.

Thus, the organelle is Golgi bodies.

For more details regarding Golgi bodies, visit:

https://brainly.com/question/13274076

#SPJ2

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

Can podocyte cells in the Bowmann capsule attach to any other basement membrane other than the glomerular basement membrane? That is, it can itself have a separate layer of base membrane?​

Answers

Answer:

"Podocytes are cells in the Bowman's capsule in the kidneys that wrap around capillaries of the glomerulus. Podocyte cells make up the epithelial lining of Bowman's capsule, the third layer through which filtration of blood takes place.[1] The Bowman's capsule filters the blood, retaining large molecules such as proteins while smaller molecules such as water, salts, and sugars are filtered as the first step in the formation of urine. Although various viscera have epithelial layers, the name visceral epithelial cells usually refers specifically to podocytes, which are specialized epithelial cells that reside in the visceral layer of the capsule. "

Explanation:

hope this helps

If a cell has 24 pairs of chromosomes in its diploid state, how many
chromosomes will it have after Meiosis 2?
A. 12
B. 24
C.48
D. 6

Answers

Answer:

option A is correct that is 12

Explanation:

meiosis occur in two phases in first phase DNA replication occur and amount of DNA become doubled without any change in the chromosome number and two daughter cell (each 2 n)are formed.

now in stage 2 each daughter cell undergoes mitosis with the formation of two cells with half chromosomes(n)

now 2n=24

n=24/2 =12

after meiosis stage 1...........two daughter cell each with  24 chromosomes

stage 2 .............each daughter cell form two grand daughter cell each with 12 chromosomes

net result.......4 daughter cell each with 12  chromosome(assuming cell as a diploid cell)

If a cell has 24 chromosomes before cell division then the daughter cell resulting from the mitotic division will have 24 chromosomes while the daughter cell resulting from the meiotic division will contain 12 chromosomes each.

The answer is option A.

What are meiotic and mitotic cell divisions?

There are sorts of cell departments: mitosis and meiosis. most of the time whilst humans discuss “cellular division,” they suggest mitosis, the procedure of making new frame cells. Meiosis is the sort of cell division that creates egg and sperm cells. Mitosis is an essential technique for lifestyles.

Learn more about mitosis and meiosis here: https://brainly.com/question/11842063

#SPJ2

Imagine an invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have:____. a. a cyclic variation depending upon when the animal drinks. b. regular variations that range from large to small. c. slight fluctuations that are kept within a narrow range. d. a cyclic variation opposite that of the surrounding water.

Answers

Answer: Option C.

slight fluctuations that are kept within a narrow range.

Explanation:

An invertebrate that lives in an estuary where salinity varies cyclically with the tides. If this individual is able to adjust the salt concentration of its body fluids, its salt concentration will have slight fluctuations that are kept within a narrow range so has to maintain homeostasis and prevent the cells of the the invertebrate from not shrinking which can be due to the salt solution (Hypertonic).

Estuary is an area of water or shorelines where river meet the ocean. It normal do have concentration of salts. Organisms that live in estuaries must be able to adapt to their dynamic environments, wich is due to variations in water chemistry includes salinity, as well as physical changes like the rise and fall of tides.

Scientists are able to reproduce certain plants and animals by cloning them in laboratories. The diagram shows the steps of cloning using tissue cultures. Do you think cloning is a form of asexual reproduction? Explain your answer using evidence from the diagram

Answers

Answer:

Yes.

Explanation:

Yes, cloning is a form of asexual reproduction because there is no fusion of sperm and eggs takes place. the animal which is formed from this process is identical of that organism because it is produced from the tissue of that single animal. in 1996, first mammal is produced from cloning was sheep named dolly at the Roslin Institute in Scotland. In cloning, the egg is taken from female organism and remove the nucleus from the egg then the desired organism cell is taken and fuse with the nucleus with the help of electricity. Then implant this embryo in the body of first organism from where egg is taken and after that the embryo turns into a baby, this process is called cloning.

Answer:

Yes, cloning is a form of asexual reproduction. The diagram shows that new plants form from a single parent plant, which means that the offspring are genetically identical to the parent.

Explanation:

Edmentum

Which is most likely a source of air pollution? littering CFCs oil spill runoff

Answers

Answer: CFCs

Explanation: The other options aren’t as relevant to air pollution.

Answer:

cfcs

Explanation:

A gamete is best described as what?
A. The protective outer layer of an egg cell.
B. An enzyme in a sperm used to digest the egg cell's membrane.
C. A haploid cell produced for reproduction.
D. A diploid cell produced for reproduction.

Answers

Answer:

C. A haploid cell produced for reproduction.

Explanation:

The term "gamete" refers to reproductive cells such as sperm and ova. Sperm and ova are both haploid cells that unite to form diploid cells.

name 3 physiological processes of cell membrane?{3mks} plz help me guys

Answers

Answer:

the cell membrane is an extremely pliable structure composed primarily of back -to- back phospholipids (a "bilayer")

Atmospheric nitrogen can be fixed by nitrogen-fixing bacteria. Arrange the following forms of nitrogen from the atmospheric N stage to the final form that enters the roots. 1. Ammonia 2. Nitrogen gas 3. Ammonium ion 4. Nitrite 5. Nitrate

Answers

Answer:the answer is ammonia

Explanation:the nitrogen fixing bacteria fix the nitrogen as ammonia

Consider the cladogram. A cladogram is shown. Roundworms have the derived characteristics of true tissues, bilateral symmetry, and a pseudocoelom. Which group of organisms has the derived characteristics of true tissues, bilateral symmetry, and a pseudocoelom? sponges roundworms annelids chordates

Answers

Answer:

The correct answer is - roundworms.

Explanation:

The answer is already mention in the question, however, the detailed answer is as follows:

The characteristics that are given in the question are true tissues, bilateral symmetry, and a pseudocoelom. Worms or helminths are known as primitive form of organization of the Bilaterians. All three group of worms or helmints have a basic bilateral symmetry.

These organisms inaugurated various characteristic that are found and carried by other animals such as  true tissues, bilateral symmetry, and a pseudocoelom.

Thus, the correct answer is - roundworms.

Answer:

its b

Explanation:

which best describes bacterium?

Answers

Answer:

Bacteria (singular: bacterium) are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids. Hope this helps :))

Explanation:

Answer:

Bacteria are classified as prokaryotes, which are single-celled organisms with a simple internal structure that lacks a nucleus, and contains DNA that either floats freely in a twisted, thread-like mass called the nucleoid, or in separate, circular pieces called plasmids.

Explanation:

Why was the Nationalist Party more popular in China’s cities than in the countryside? Wealthy people who supported the party were concentrated in cities. People in the countryside were less active in politics than people in the city. Poor city dwellers hoped the Nationalist Party would bring economic change. The Nationalist Party threatened to end crop trade with Western nations.

Answers

Answer:

Wealthy people who supported the party were concentrated in cities.

Explanation:

Answer:

The answer is A on edge

Explanation:

Why is it necessary to separate oxgynated blood and deoxgynated blood in living organisums?

Answers

Answer:

For efficient transportation of blood.

Explanation:

2) Micah and Taylor investigate the effect of tap water and spring water on the growth of plants.

They grew two plants of the same type and size in separate containers. Every three days, they

added the same amount of tap water to one plant and the same amount of spring water to the

other. Describe an action that would best improve the reliability of their results?

Answers

Answer:

To improve the reliability of the results, the nutritional component of each category of water must be tested and recorded.

Second, the experiment should be carried out under greenhouse conditions.

The above actions will afford more control. When an experiment is controlled, it means that except for the dependent variable, all other variables are kept constant by the scientist.

By performing the experiment under greenhouse conditions, the kind of water the plants receive, temperature and other biotic actors are kept within measurable limits thus increasing the reliability of the results.

Cheers!

What results if a broken chromosomal fragment becomes reattached as an extra segment to a sister or non-sister chromatid? A Duplication B Inversion C Polyploidy D Nondisjunction

Answers

Answer:

The correct answer is option A "Duplication".

Explanation:

Chromosomal duplication is defined as a type of rearrangement of genetic material at which extra copies of a DNA fragment are created. In this case if a broken chromosomal fragment becomes reattached, this fragment will represent an extra copy, and therefore the resultant genetic material is considered a chromosomal duplication.

Which ecosystem service would suffer from the opening of a mineral mine along a small mountain range?

A. Cultural
B. Provisioning
C. Regulating
D. Supporting

Answers

Answer:

D. Supporting

Explanation:

Ecosystem services include provisioning, regulating, culture and supporting services.

Opening of a mineral mine along a small mountain range will affect the supporting services of ecosystem because supporting services deals with soil formation, provision of habitat and nutrition cycle.

Opening of mineral mine will destroy the tosoil, landscape, forests and wildlife of mountain area which affect the supporting services such as habitat and soil formation.

Hence, the correct answer is "D. supporting".

how do each of the following factors affect the productivity in this process of photosynthesis ? 1)Temperature 2) Water 3) carbondioxide

Answers

Answer:

without the right amount of temperature and water photosynthesis won't take place and without the presence of carbon dioxide...there is nothing like photosynthesis

Explanation:

1) Temperature- Above 28°C of temperature photosynthesis will not take place faster as necessary. At this temperature, the enzymes responsible for photosynthesis will not work efficient as needed .  2)Water and 3)Carbon Dioxide-Water and carbon dioxide are the reactants in Photosynthesis which means they are taken in to produce energy. Six molecules of water and six molecules of carbon dioxide are needed to break apart glucose and produce energy.

Hope the answer helps! Don' forget to mark brainliest if the  answer is truly the  best. Thank you!

While performing an experiment, it is important to:
a. change the control setup
b. test many different variables at the same time
c. reach a conclusion
d. record observations and measurements

Answers

Answer:

D

Explanation:

While performing an experiment, it is important to record observations and measurements, as in Option d. Option d is correct regarding the facts of the experiments, while the others are wrong.

What is an experiment?

The experiment is carried out to observe the hypothesis, and in this process, a control set-up is taken whose value or result is already known, and the variables are taken and compared with the control. The controls set should never change in the experiment because the variables are tested with reference to them, and the measurements and observations of the experiment should be taken into consideration to prove the hypothesis. All the variables should not be tested at once because if this is done, it would introduce error into the experiment, and not all the experiments are done to get the conclusion.

Hence, while performing an experiment, it is important to record observations and measurements, as in Option d.

Learn more about the experiment here.

https://brainly.com/question/11256472

#SPJ2

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

Which organelle is the primary site of protein production? A) nucleus B) ribosomes C) cytoplasm C) cell membrane

Answers

Answer: b

Explanation:

Just trust

Answer:

B, ribosomes :)))))

Explanation:

Proteins in the cell membrane have many functions. Which type of protein would be used for cell recognition and as a receptor? A. Pore proteins B. Endoplasmic proteins C. Glycoproteins D. Integral proteins

Answers

Answer:

C. glycoproteins

Explanation:

Glycoproteins are proteins containing glycans (oligosaccharide carbohydrates) attached to amino acid side chains. These oligosaccharides are attached to the amino acid chain by a posttranslational modification referred to as glycosylation, a modification generally found in extracellular regions. Glycosylation refers to the chemical reaction in which a glycosyl donor (i.e., the carbohydrate) is attached to a functional group in the protein. The glycosylation sites play distinct functional roles for both cell interactions and cell recognition. Moreover, glycosylation sites are also essential for substrate recognition by an enzyme. For example, secreted cytokines are glycosylated, which is required for their binding to receptors.

Match each hormone to its function
•luteinizing hormone
•testosterone
•oxytocin
•follicle-stimulating hormone
•estrogen
•gonadotropin-releasing hormone

Answers

Answer: Stimulates the contraction of the uterus during childbirth - OXYTOCIN

Stimulates sperm production and growth of ovarian follicles - FOLLICLE STIMULATING HORMONE

Initiates the Secretion of leutinizing hormone and follicle stimulating hormone - GONADOTROPIN RELEASING HORMONE

Initiates the development of secondary sex characteristics in females - ESTROGEN

Initiates the development of secondary sex characteristics in males - TESTOSTERONE

Initiates cell production of testosterone and estradiol by cells in the gonads - LUTEINIZING HORMONE.

The correct match for hormone and their functions are- 1- Oxytocin, 2- follicle-stimulating hormone, 3- a gonadotropin-releasing hormone, 4- estrogen, 5- testosterone, and 6- luteinizing hormone.

Oxytocin is a naturally occurring hormone that plays a vital role in the reproductive system of both men and women, including labor, delivery, and breastfeeding, as well as in human behavior.

FSH is produced by the pituitary, which is a small gland just below the brain. The pituitary plays a vital role in the development and regulation of sexual function.

Gonadotropin-releasing hormone stimulates the brain’s pituitary gland to produce and release the hormones LH and FSH.

Estrogen is a family of hormones that play a vital role in the reproductive and sexual development of women.

Testosterone is a male sex hormone. It is responsible for spermatogenesis and fertility in males.

Luteinizing hormones (LH) are hormones in the body that stimulate the reproductive system. Luteinizing hormone stimulates ovulation and stimulates the production of the hormones needed for pregnancy

To learn more about estrogen, refer to the link:

https://brainly.com/question/30246077

#SPJ6

The scientist has chosen to study the motion of clouds in the atmosphere during a thunderstorm which type of model is most appropriate for her investigation

Answers

Answer: COMPUTER SIMULATION

Explanation: Computer simulation is a model that helps to scientists to have a clear and better understanding and be able to effectively predict the occurrence of future outcomes of real physical situations.

Computer simulation makes use of mathematical models to effectively analyse and predict future occurrences which helps the world to be better prepared and able to effectively manage physical and real world situations.

3. Which plants are usually the first to grow during secondary succession?
A ferns
Blichens
Cweeds
D trees

Answers

Answer:

ferns

Explanation:

these are alsi known as conifers which require a great amount if light

Im not a science student just trying beans I guess

Other Questions
A Markov chain has 3 possible states: A, B, and C. Every hour, it makes a transition to a different state. From state A, transitions to states B and C are equally likely. From state B, transitions to states A and C are equally likely. From state C, it always makes a transition to state A. (a) If the initial distribution for states A, B, and C is P0 = ( 13 , 13 , 13 ), find the distribution of X2 (b) Find the steady state distribution by solving P = . What is the most likely reason fast food companies want to advertise and sell their prouducts in schools Michael is using a number line to evaluate the expression 8 3. A number line going from negative 12 to positive 12. A point is at negative 8. After locating 8 on the number line, which step could Michael complete to evaluate the expression? Mildreds salary has increased from 24,600 to 25,338. By what percentage has her salary increase? What is called "I eat rice" in nepali? change the voice, mannered boys are throwing the trash This food web reveals that, as matter flowsthrough trophic levels,A. matter from consumers, such as the green lynxspider, is eventually recycled by decomposers,such as a fungus.B.matter from producers, such as the cutleaf daisy,is immediately recycled by decomposers, suchas a bacterium.C. matters from all organisms, such as the Baldeagle, is dissipated at each level and none of itis recycled.D. matter from the Sun is recycled after many yearsby consumers, such as a Bachman's sparrow. A _____________________ established a colony and served as an agreement between thecolony and the __________________. Only the King could _________________ acharter, so technically he was in charge. y - 4= -2(x + 3)Complete the missing value in the solution to the equation.(-3, _ ) Need to find the Domain and Range mark each)1.Alfred George Gardiner was the editor of in the following sentence, identify the part of speech of the word swiftly: Large fish swim swiftly in the sea What is the function of a heart rate monitor?O to monitor blood pressureO to track abnormal heart rhythmO to estimate VO2maxO to track how fast a heart beats when the point ( k, 3 ) lies on each of these lines, find the value of k y= 3x+1 , y= 4x-2 , y=1/2x - 1 and 2x+3y=4 The arrangement of leaves on a tree branch that reduces overlapping and overshadowingof leaves from sunlight is referred to as leaf This ensures exposure of most of the leaves to sunlight for maximum ..to take place in the of leaf cells. The grana contains numerousmolecules which trap light.for .of water, producing atoms required for the process of carbon (IV) oxidein the lightstage of photosynthesis which takes place in the..of the chloroplast. PLEASE HELP ME ITS MY LAST ONE!!! Read the sentences, look at the image and match each sentence with the name of the royal family member missing in the blank. Terms: La hermana de Sofa es ________. El padre Leonor es ________. La madre Leonor y Sofa es ________. La abuela de Leonor y Sofa es ________. Choices: A) Felipe IV B) Leonor C) Sofa D) Letizia A property sold for $198,000 with a listing commission of 8%. The selling office is to receive 40% of the total commission. How much will the listing salesperson receive if she is paid 60% of the amount retained by the listing broker? Carter Company reported the following financial numbers for one of its divisions for the year; average total assets of $4,100,000; sales of $4,525,000; cost of goods sold of $2,550,000; and operating expenses of $1,372,000. Compute the division's return on investment: I need help please, m bda = And m bca = I put in 60 points but i think the thing changed is going to change it to 30 + brainly i will give brainliest to best answer Define and describe in detail (and in your own words) ultrasound and infrasound Describe how ultrasound and infrasound are used in specific industrial applications and provide detailed examples. 350 words thanks plz plz plz no funny answers i am using a lot of points on this because i really need help not ignorant people who just want points