pLeAsE HeLp Will mark brainliest


Explain the Columbian Exchange effects on the Eastern and Western Hemsiphere

Answers

Answer 1

Answer:

Exchange of plant and animal species, but also certain negative phenomena.

Explanation:

"With Europeans' arrival on the soil of North America, there was an exchange of certain plant and animal cultures. However, that contact also had negative connotations. Europeans also brought certain infectious diseases such as the flu and smallpox to which the natives did not have a developed immune system. These diseases have decimated, in some cases, the entire tribal communities of North America.

When we talk about exchanges of plant and animal species, Europeans took over potatoes, tobacco, tomatoes, corn, and some other crops from the natives. On the other hand, the natives got acquainted with wheat, onions, and pigs, and horses."


Related Questions

How did Stephen F. Austin’s arrest contribute to the start of the Texas revolution ?

Answers

Escalating the tensions that would lead to rebellion and war, the Mexican government imprisons the Texas colonizer Stephen Austin in Mexico City.

Stephen Fuller Austin was a reluctant revolutionary. His father, Moses Austin, won permission from the Mexican government in 1821 to settle 300 Anglo-American families in Texas. When Moses died before realizing his plans, Stephen took over and established the fledgling Texas community on the lower reaches of the Colorado and Brazos Rivers. Periodic upheavals in the government of the young Mexican Republic forced Austin to constantly return to Mexico City where he argued for the rights of the American colonists in Texas, representing their interests as a colonial founder. Yet, Austin remained confident that an Anglo-American state could succeed within the boundaries of the Mexican nation.

What types of persecution did the Roma face before, during, and after the Holocaust?

Answers

Answer:

n 1933, police in Germany began more rigorous enforcement of pre-Nazi legislation against those who followed a lifestyle labeled "Gypsy." The Nazis judged

Explanation:

Answer:

German department began enforcing pre-Nazi rules against those who maintained a Gypsy lifestyle more aggressively in 1933. The Nazis made their choice.

Explanation:

Who won WWI?
You know life is goin bad when you have to rely on kind strangers from the internet to make you feel better.

Answers

Answer:

dang that hit me....i've just been lying to myself-

Explanation:

Answer:

In World War I, the Allied Powers ended up as the winners. The main countries that were part of the Allied Powers were the United Kingdom, France, and the United States. Russia had been part of the Allied Powers at the start of the war but ended up surrendering after the Russian Revolution.

Who is known as light of Asia​

Answers

Answer:

"Gautam Buddha"

What is the title of the traditional song that is customarily sung on New Year's Eve?
Group of answer choices

A) Auld Lang Syne

B) What are you doing New Year's Eve?

C) Old Lansing

D) I Left My Heart In San Fransisco

Answers

Answer:

Hope this helps!! :)

Explanation:

A) Auld Lang Syne

other ones are incorrect.

What are some similarities between British and American culture?

Answers

Answer:

Probably the most important similarity should do with the link of the citizen to the state. while the USA could be a lot more libertarian than the united kingdom is, both nations' current cultures arose out of Anglo-American Enlightenment wondering Liberty-with-a-capital-L. If you contrast them with France, France includes a much more bureaucratic government; permission is required for lots of things; the solution is incredibly often "no," and civil servants have an inclination to be high-handed. French culture is ring-fenced... maintained by government fiat.

Explanation:

17. What is the Reconstruction Finance Corporation (RFC)

Answers

The Reconstruction Finance Corporation was a government corporation administered by the United States Federal Government between 1932 and 1957 that provided financial support to state and local governments and made loans to banks, railroads, mortgage associations, and other businesses.

Answer:

The Reconstruction Finance Corporation was a government corporation administered by the United States Federal Government from 1932 to 1957. It provided financial support to state and local governments and made loan to banks, railroads, mortgage associations and other businesses.

Explanation:

The RFC had initial success but never reached its intended impact, the RFC was viewed by many American's as a relief program for big business only.

Method in which the government branches (legislative, executive, judicial) limit each other's power. Select one: a. Control of the Senate elections b. Declaration of Independence c. Humanistic voting d. Checks and balances

Answers

Answer:

Explanation:

checks and balance

Answer:

it is definitely d checks and balances

Explanation : i took quiz

Did imperialism improve the lives of those who were colonized?

Answers

It depends, so yes and no at the same time

Negatives: Imperialism led the world into the business of slave trading which then led to social discrimination around the world. Damaging the cultures and the built-up disunity among the natives ( the people who were colonized ). Imperialism also had stripped multiple countries off their natural resources and left nothing for those who were colonized.

Positives: With imperialism, the technology was improved by a ton. There were new crops to be found, new tools and easier farming methods for people. This all increased food production in the days which these changes meant a lesser amount of death to smaller colonies and nations. ( Overall improving the state of living to say ) Living longer lives and having a better sanitation compared to without or the early days of imperialism

Dubai has been compared to a "salad with a cucumber and tomato on top," when talking about multiculturalism. Choose the answer that best explains why this is.

Answers

Answer:

Some cultures feel more accepted than others in Dubai.

Explanation:

Multiculturalism is a term used to describe the cultural diversity, where people from different countries and cultural backgrounds come together in one place to live. Dubai is being compared, to a salad with a cucumber and tomato on top because it has accepted people without any restrictions.

Answer:

b. Some cultures feel more accepted than others in Dubai.

Explanation:

I NEED HELP PLEASE Which of the following was true concerning the International Brigade: A) It received financial aid from Germany and Italy. B) It was defeated by Fascist and Nazi troops. c) It supported Francisco Franco. D) it was organized after the Spanish Civil War.​

Answers

By process of elimination, I believe the answer to be B.

A is incorrect because they were fighting against the international brigade.

C is incorrect because Francisco Franco was the leader of the opposing side in the civil war.

D is incorrect because it was formed for the Spanish civil war and was disbanded after it.

How did the political systems of the Natchez and the Iroquois differ?

Answers

Answer:

What is the difference between the Natchez and the Iroquois political system? That the Iroquois was a more democratic political system. ... They also developed a system of numbers that included the number zero

What 3 events happened before March 5, 1770 to increase conflict between the Boston colonists and the British?

Answers

Answer:

Three events that can be mentioned are imposing of Quartering Act (1765), Stamp Act (1767) and Townshend Act (1767 - 1770).

Explanation:

I have choose these three events as they were seen as problematic by the colonist as it deprived them of their rights. Quartering act made colonist shelter British soldiers, while Stamp Act made the colonist to pay taxes for every legal document. Finally, Townshend acts were series of taxes that totally angered colonists.

What are hunter-gatherers? How do they use the environment to survive? Provide an example of early hunter-gatherers in North America. Write your answer using four or more complete sentences.

Answers

Early hunter-gatherers moved as nature directed, altering to expansion of vegetation, the nearness of predators or dangerous storms. Essential, impermanent covers were set up in caves and other ranges with defensive shake arrangements, as well as in open- air settlements where conceivable. The ancient hunter-gatherers lived in small groups,  they were routinely on the move, looking for nuts, berries and other plants and taking after the wild creatures which the guys chased for meat.

Explanation:

Tell me if you got it wrong or right

If its right may I please have brainliest?

Answer:

Hunter gatherers are groups of people who move from place to place in search of food and other needed natural resources. They rely heavily on the environment for everything they need to survive, including food, shelter, clothing, tools, and even medicines. For instance, these groups will use every part of a hunted animal to survive: meat is used for food, skin for clothing and shelter, and other remains for tools and weapons. These groups will also gather any nuts, berries, and fruits they can find. The Paleo-Indians were early hunter-gatherers in North America. Most early human groups were until they began to domesticate plants and animals.

Explanation:

I hope this helps

And give other person brainliest ↑↑

You are rolling a 6-sided number cube with the
numbers 1 through 6. Which of the following represent
the probability of rolling an even number?
0
1/6
1/2
1

Answers

Answer:

1/2

Explanation:

1,3,5=odd

2,4,6=even

6-3=3. =1/2

Answer:

1/2

Explanation:  


Which is the correct order for impeachment proceedings?
The Senate brings charges of misconduct; the official is removed.
The House brings charges of misconduct; the Senate holds an impeachment trial; the official is
removed if found guilty.
The Senate brings charges of misconduct; the House holds an impeachment trial; the official is
removed if found guilty.
The House brings charges of misconduct; the official is removed.

Answers

the second one, the house brings charges, then the senate votes on them, then (if the senate votes it) the official is removed. hope this helps!

Which developing countries are among the world's top current etters of carbon dioxide? (Select all that apply.)
A. Sudan
B. India
C. Mexico
D. China

Answers

B India and D China

Which of these was MOST impacted by Johnson's "Great Society" programs?

A) Space exploration
B) stock Market reform
C) insurance for the disadvantage
D) defense spending to stop communism

Answers

Insurance for the disadvantage (C) was most impacted by Johnson's "Great Socety" programs.

What was the result of the second Continental congress?

Answers

Answer:

printing money, foreign aid, raising an army, getting loans

Explanation:

This congress acted much more like a government sending ambassadors to foreign countries, printing its own money, getting loans, and raising an army. Major accomplishments of the Second Continental Congress: On June 14, 1775 they established the Continental Army. They made George Washington General of the Army.

Reflect on the following: How did the Gettysburg Address affect America socially?

Answers

Answer:

well Gettysburg address affected america socially by

Explanation:

and why he did it like that is because of


Identify 3 key ideas from the Enlightenment that influenced the American Revolution

Answers

freedom of speech, religious freedom, freedom of the press, equality under the law, separate branches of gov

Answer: Enlightenment ideas which are, freedom of speech, equality, freedom of press, and religious tolerance.

What did Washington warn against in his Farewell Address?
Options:

A)

Electing the wrong person

B)

Political party infighting

C)

Neutrality in foreign wars

D)

A strong national government

(Thank you)

Answers

Answer:

its A

Explanation:

The main reason people migrated to Sun Belt states in the 1950s was
to move to Northern cities.
to gain employment opportunities.
to avoid very warm climates.
to gain educational opportunities.

Answers

To avoid very warm climates

I’m sorry if I’m incorrect

Answer:

it is to gain employment opportunities, so the second option or B.

Explanation:

I took the quiz on ed 2021

Why did many Americans fear Vladimir Lenin and his followers, the communist?

Answers

Answer:

Vladimir Lenin had successfully brought the USSR on the global stage after the Communist Revolution. At the time the Russian Empire was growing unstable but it still was the biggest country in the World. This could strike fear in the eyes of Americans as the biggest country had collapsed and turned into a Communist powerhouse. This would've most likely caused a 'Red Scare" in the US and Europe. As Russia was the advocator of Communism, places in the US also had small communist uprisings which made citizens even more unsettled.

Answer:

First of all his followers weren't communist

Explanation:

They had a form of currency and different classes such as upper and lower classes. You can't have a communist society if there is money, state, and classes, and the means of production are privately owned. Hope this helps.

answer pleasee thank you​

Answers

Answer:

A

Explanation:

How did Aryan culture explain the use of the caste system

Answers

Answer:

caste system is for controlling the local population

Explanation:

How did the period of Reconstruction change the representation of African American men?

Answers

The Reconstruction implemented by Congress, which lasted from 1866 to 1877, was aimed at reorganizing the Southern states after the Civil War, providing the means for readmitting them into the Union, and defining the means by which whites and blacks could live together in a non-slave society.

Why did the Age of Imperialism begin?

Answers

Answer:

In the Age of New Imperialism that began in the 1870s, European states established vast empires mainly in Africa, but also in Asia and the Middle East. European nations pursued an aggressive expansion policy that was motivated by economic needs that were created by the Industrial Revolution.

Explanation:

list and describe 3 architectural features developed or maybe popular by the romans

Answers

Answer:

Explanation:

(1) Use of Corinthian style columns

(2) Use of cement in construction (not sure if the Romans invented cement, but we know they used it)

(3) Construction of facades at the front of major buildings

The Free-Soil Party was a precursor to which political party?

Answers

It was a coalition political party and then merged into a Republican Party (hope this helped)
Other Questions
Simplify 5(x - 2) - 3x + 7.A. 8x - 3B. -10x + 25C. 2x-5D. 2x - 3 I need help ASAP please Which sentence is best structured to present two ideas of equal importance?A. Since NASA was founded, it has sent more than 250 astronautsinto space.B. The mission of NASA is to explore outer space.C. Some people think that NASA should focus on exploring theuniverse, but others believe that building a colony on the moon isthe most important goal, even though it will be difficult.D. NASA is known for sending humans to the moon, but the famousspace program has also sent an unmanned spaceship to Mars. DETERMINE THE MISSING SIDE Creative block! I WILL GIVE BRAINLIEST AND 5 STARS.... PLEASE HELP!!! using all my points for this!!!either give me a topic idea or the full essay it can be 240 words or something too my teacher will accept that. It is just for a lesson question so no pressure if it is 200 words or less I can work on it and add more words I just need a skeleton essay because I am having writers block."Select an environmental issue faced by the countries of this region. Write an essay of 300 words describing the problems presented by your chosen issue and possible solutions to the problem." A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25? What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4THESE ARE THE OPTIONS 2,3,4, -5O 2a, 3b, 4c-5a, 82a, -5a, 8, -4HELPP Hurry need an answer anyone know how to do this? What is the mRNA and Amino Acids for: TACACCTTGGCGACGACT What caused the original creation of the Universe? How do we find out? A duck walked up to a lemonade stand and he said to the man running the stand: Solve the system by substitution.x - 5y = 1- 2x + 9y = -1 what is the solution? Create a flow chart that shows the hierarchy of the US Banking Systems. which is the correct graph for the equation? TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Bryan wants to buy a new pair of jeans. If the jeans were originally $45.00, but are on sale with a 20% discount, how much will Bryan have to pay for the jeans? MR. ARCEO TAKES A TAXI FROM THE AIRPORT TO A HOTEL. THE TAXI CHARGES $2.50 INITIAL CHARGE PLUS $2.65 PER MILE. WHICH EQUATION CAN BE USED TO FIND Y, THE TOTAL COST OF THE TRIP, IF X REPRESENTS THE NUMBER OF MILES OF THE TRIP? Someone pls help Im not sure Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs?