please help me fill the squares

Please Help Me Fill The Squares

Answers

Answer 1

Answer:

that is basically it. I'm just adding works so I can send this

Please Help Me Fill The Squares

Related Questions

write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond​

Answers

(See the attached picture)

Direction: Write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond.

Answer:

The goal of the sperms’ journey to the egg is to fertilize it. To do so, the sperm cell must pass through a long and challenging path. This is one of the reasons why the total number of motile sperm cells is very important, and a key parameter for a man’s potential to reach pregnancy with his partner.

The sperms’ journey to the egg begins with millions of sperm cells that are released into the female reproductive tract during intercourse. The sperm cells gain their full ability to swim when they are ejaculated into the reproductive tract.

Upon ejaculation, the sperm cells are enclosed in a fluid called seminal plasma or semen, which is a mix of fluids from the testes, seminal vesicles, prostate, and the bulbourethral glands. The fluid contains elements which protect the sperm cells during their journey towards the egg. The semen thickens and helps the sperm cells stay inside the woman – as close as possible to the cervix, which is the “gate” to the egg.

Liquid extends from the cervix, allowing the sperm cells from the semen to swim into the cervix. Only the strongest sperm cells will make it this far. Once through the cervix, the sperm cells swim across the uterus and into the fallopian tubes.

I hope it helps!!

The sperm cell fertilizes the egg and forms a zygote, which is further divided into multiple cells and becomes a child. The division is the process of mitosis that takes place from the zygote to the child's development.

How is the zygote formed and developed?

The sperm and the ovum are produced by the process of meiosis from the male and female, respectively, and when both fertilize, the zygote is formed. The fertilized zygote is a single cell, but later that cell is further divided mitotically and forms a morula, then a blastula, and then the gastrula.

The cells of the gastrula undergo cell differentiation, different organs are developed, and the baby is finally formed. The child then continues to grow in size, and different organs grow and form the mature organ system. After a certain age, the reproductive organs start to mature and are capable of forming the gametes.

Hence, all of these events occurred from the zygote to the child's maturity.

Learn more about the zygote here.

https://brainly.com/question/465851

#SPJ2

If earth’s atmosphere is made up of 78% nitrogen, why is nitrogen a limiting factor for producers?
A.
Consumers respire all of the available nitrogen.

B.
Nitrogen is unusable in its liquid form.

C.
There are more plants than gaseous nitrogen.

D.
Nitrogen is unusable in its gaseous form.

Answers

d is the answerrrrrrrrrr



What is the
Magnification
of a plant cell?

Answers

Answer:

400x

Explanation:

Mr. and Mrs. Green have a daughter, Georgia, who was born at Riverside Community Hospital. Mr. and Mrs. Blue have a daughter, Belle, who was born on the same date at the same hospital. Mrs. Green, having recently seen Belle, is convinced that Belle and Georgia had been assigned to the wrong parents at the hospital. Mrs. Green thinks that Belle is her biological daughter. ABO blood analysis was performed on all individuals involved:Mr. Green: Type AMrs. Green: Type A Georgia: Type AMr. Blue: Type ABMrs. Blue: Type ABelle: Type O
Is Mrs. Green correct? Is Belle her biological daughter? Explain.

Answers

Answer:

Yes, Mrs Green is correct that Belle is her biological daughter

Explanation:

According to this question, Mr. and Mrs. Green is said to have a daughter, Georgia while Mr. and Mrs. Blue is said to have a daughter, Belle. Both daughters were born the same day. Hence, a controversy occured as Mrs. Green thinks that Belle is her biological daughter.

Based on the blood analysis, the following were obtained:

Mr. Green: Type A

Mrs. Green: Type A

Georgia: Type A

Mr. Blue: Type AB

Mrs. Blue: Type A

Belle: Type O

The genotype of the following blood types is as follows:

Type A - iAiA or iAi

Type B - iBiB or iBi

Type O - ii

Type AB - iAiB

From the analysis of blood types of Mr and Mrs Green, which are both type A, they can possibly produce a child with type A.

However, from the analysis of Mr. and Mrs. Blue, it is impossible to have a child with blood type O. However it is possible for Mr and Mrs. Green if they are both heterozygous (iAi × iAi). The punnet square is attached. Hence, Mrs Green is correct about her claim since Mr. and Mrs. Blue cannot have a child with blood type A.

1. Lactose takes years to break down on its own. But if exposed to the protein lactase, the reaction proceeds very quickly, while lactase itself remains unchanged. Lactase is an example of a(n) . 2. A(n) is a molecule that can bind to an enzyme and prevent the enzyme from working. There are two types: a(n) binds to the active site of the enzyme; a(n) binds elsewhere on the enzyme. 3. Enzymes speed up chemical reactions by lowering the , which allows the reaction to proceed much more quickly. 4. During an enzymatic reaction, a molecule of binds to the enzyme and is broken down into one or more molecules of , which are released. 5. The specific location within an enzyme molecule where the substrate binds is called the .

Answers

Answer:

1.) Lactase is an example of ENZYME.

2.)An INHIBITOR is a molecule that can bind to an enzyme and prevent the enzyme from working.

3.)Enzymes speed up chemical reactions by lowering the ACTIVATION ENERGY,

4.) a molecule of SUBSTRATE binds to the enzyme and is broken down into one or more molecules of PRODUCT which are released.

5.) The specific location within an enzyme molecule where the substrate binds is called the ACTIVE SITE.

Explanation:

An enzyme is defined as the substances that aids in the breaking down of complex food substances, taken in by animals, into simple, soluble and diffusible substances before they can be absorbed into the body. In the enzymatic reactions, a molecule of SUBSTRATE binds to the ACTIVE SITE of an enzyme and is broken down into one or more molecules of PRODUCT which are released.

There are different types of enzymes which are named according to the type of good they digest, these include:

--> Lactase: breaks down Lactose

--> proteases: breaks down proteins

--> Amylases: breaks down carbohydrate

Enzymes have the following characteristics:

--> They are proteins

--> They are specific in action. For example Lactase can only act on lactose.

--> They can be inactivated by INHIBITORS.

--> They are sensitive to temperature

--> They speed up a reaction by lowering the ACTIVATION ENERGY

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

Which of the following is a subsystem of an organism?Please explain and I give you 5 stars.
A.cell
B.organ system
C.tissue
D.all of the above

Answers

Answer:

D

Explanation:

In multicellular organisms, the body is a system of multiple, interacting subsystems. Subsystems are groups of cells that work together to form tissues. Interactions are limited to the circulatory, excretory, digestive, respiratory, muscular, and nervous systems.

D. All of the above

What does the prefix "hetero-" mean?
A. Same

B. Different

Answers

I would say different
Like you like different genders

Answer:

B. Different

Explanation:

What is an amino acid

Answers

Amino acids are organic compounds that contain amino and carboxyl functional groups, along with a side chain specific to each amino acid. Hope this helps!!<3

Answer:

i dont know

Explanation:

bgggfbjn

99% of the GMOs on the planet are ____
or ____

Answers

Answer:

The answer would be pesticide producers and herbicide resisters.

Explanation:

Hope this helped!

How does convection cause ocean currents?
A. During the process of convection, energy is transferred to the atmosphere forming winds. These winds power surface currents.
B. During the process of convection, the heating of surface water by the sun results in upwelling.
C. During the process of convection, energy in warm water is lost to its surroundings. The water cools, becomes denser, and sinks.
D. During the process of convection, more minerals and gases dissolve in warm water. This increases the density of the warm water and causes it to sink.

Answers

Answer:

C. During the process of convection, energy in warm water is lost to its surroundings. The water cools, becomes denser, and sinks.

Explanation:

Convection refers to the process of transference of heat from one place to another by the movement of gas/liquid particles. Convection occurs when a gas or liquid substance is heated, thereby it expands (increase its volume) by gaining kinetic energy and moving far apart. Energy in the atmosphere and oceans is transferred mainly by convection. In the atmosphere, convection produces wind belts. Moreover, an ocean current is the result of the continuous movement of seawater caused by different forces acting upon the water (i.e., wind, the Coriolis effect, waves, temperature). In the oceans, convection produces currents because the seawater heats up becoming less dense and moves above cooler seawater, emitting heat during the process and causing the continual circulation of water.

Answer:

c

Explanation:

is eczema recessive or dominant? explain why or how.

Answers

Answer:

When caused by CARD11 gene mutations, atopic dermatitis has an autosomal dominant inheritance pattern , which means one copy of the altered CARD11 gene in each cell is sufficient to cause the disorder.

Explanation:

pls mark brainlest

Please help me with please

Answers

no so do it yourself and get smart

Suggest one other use of glucose in a potato plant that's still growing below ground

Answers

Answer:

glucose is used to make cell walls, make protein amd stored as starch.

Hi, I don’t know what the other uses were in the question for which you can’t use but I have a couple.

> Produce respiration
> Store starch underground, so I knew plant can grow
> Glucose which is soluble is converted into insoluble starch for storage

Hope this helps :)

Which of the following best describes the producers in a terrestrial food web?

A) They are at the top of the energy pyramid.
B) They obtain their energy from consumers.
C) They are unaffected by decomposers.
D) They convert energy from the sun to chemical energy.

Answers

Answer:

The correct answer is - D. They convert energy from the sun to chemical energy.

Explanation:

In any food web, producers are the organism that can make their own food and energy by converting light energy coming from the sun into chemical energy, this process called photosynthesis.

Normally producers are green plants. These are present at the bottom of the energy pyramid as these are the highest in the number. Consumers et energy from producers by feed on them.

Which of the following best represents the purpose of fertilizers?

Answers

Answer:

Fertilizer, natural or artificial substance containing the chemical elements that improve growth and productiveness of plants. Fertilizers enhance the natural fertility of the soil or replace the chemical elements taken from the soil by previous crops.

Which of the following best describes the function of the human nervous system? ​

Answers

Answer:

The nervous system gathers, interprets, and responds to information about the body's internal and external environment.

Name two traits that the most recent common ancestor of a whale and a human probably had.

Answers

Answer:

Their ancestor is most likely an ancient artiodactyl, i.e. a four-legged, even-toed hoofed ... However, whales, like humans, are mammals.

Explanation:

hope it help u

Because it is ______ , fermentation _______ oxygen.



Answers:
aerobic/requires
anaerobic/requires
aerobic/does not require
anaerobic/does not require

Answers

Answer:

anaerobic/does not require

Explanation:

anaerobic occurs in the absence of oxygen

How many amino acids must be obtained in the diet because they cannot be made by the body?
2
5
10
20

Answers

amino acids we obtained in the diet about 10

please help meeeeeeeeeee.

Answers

Answer:

T = A

A = U

G = C

A = U

A = U

C = G

Hi I need help with #1 that is shown in the image below. Pls answer and give me a explanation.

Answers

it’s option 3, both types of cells need energy to carry out their functions

Consider this plant cell. The organelles in a plant cell are labeled. Part G is the middle layer of the cell. Which organelle is labeled G?

Answers

Answer:

Hi. You didn't show the picture that shows organelle G, but since you showed that organelle is the middle layer of the cell, we can say that it is the plasma membrane.

Explanation:

In general, we can state that the plant cell has three layers, the cell wall, the plasma membrane and the cytoplasm. The cytoplasm is the inner layer, where most of the organelles and the cell nucleus are located. Above the cytoplasm is the plasma membrane, which is semi-permeable and promotes the regulation of the entry and exit of substances from within the cell. Above this membrane is the cell wall, which is an impermeable structure that protects the cell and promotes its rigidity. In this case, we can consider that the middle layer of the cell is the plasma membrane.

What is photosynthesis ​

Answers

ANSWER:

Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's metabolic activities.

CARRYONLEARNING(◕ᴗ◕✿)

photosynthesis is the process in which light energy is absorbed by chlorophyll and converted into chemical energy to form glucose

If y'all know science can y'all do dis, it's a multiple-choice question
' What is the net force required to give a box of mass 5 kg an acceleration of 4 m/s2 ?'

Answers

The answer to the question is

The number 20.

Hope this helps you. Sorry if i am wrong.

Give 2 advantages that mammals have over reptiles. Explain.

Answers

Answer:

warm-bloodedness is the main one

Explanation:

Answer:

1) Being warm-blooded gives mammals a distinct advantage in habitats

2) Mammals are important members of food chains and food webs, as grazers and predators.

3) Mammals meet people's needs by serving as pets, transport, food, or research subjects.

4) Mammals also interact with other species in many symbiotic relationships.

explain why you would recommend the nguni cattle meat to consumers in your locality?​

Answers

Answer:

Due to their natural growth.

Explanation:

I would recommend the meat of Nguni cattle to consumers in the locality because of their pure quality. These cattles have excellent resistance to internal and external parasites with natural immunity to kill borne diseases. There is no injections or vaccines are given to these cattles which enables them to grow in natural environment. So due to their natural growth, the meat have higher quality as compared to other cattle's meat.

i need help with this question

Answers

Research Question: How does various water types affect the growth of plants?

Independent Variable: Type of water

Dependent variable: plant growth

Constants: Time period (2 weeks)

Controls: type of plant, amount of soil, etc (anything you want to remain constant throughout).

Summary of human nutrition ​

Answers

Answer:

Human nutrition is the process of which substances are Transformed into tissues and energy which are used up to mental and physical activities!

which process produce two genetically distinct haploid cells

Answers

Answer:  mitosis

Explanation:

Other Questions
PlZ helppppppppppppp similarities between idea theory of meaning and reference theory of meaning Help ASAP. I will give branliest. The quantity five times a number y decreased by twelve. Group of answer choices 5y - 12 12 - 5y 12y - 5 12 + 5y Please help!find x and y At Safeway, a pound of apples cost $1.32. Mrs. Terry purchased 7.5 pounds of apples. How much money didMrs. Terry spend on apples? Distracted by her father's snoring, Alisha decided to study for her test in the kitchen.In the sentence above, what kind of phrase is underlined?A. absoluteB. prepositionalC. adjectivalD. participial I need help with a few homework, if you're willing to help PLEASE ANSWER Sam and Sally Green have a standard homeowners policy with no endorsements. The dwelling is insured for its full value. Indicate whether or not each of the following losses is covered and under what coverage. Specify why each loss is covered or not covered. a. The Green's valuable dog is stolen from their back yard.b. Sally takes off her wedding ring in a public restroom to wash her hands. She accidentally leaves the ring behind. c. While the Green's are vacationing in Europe, their hotel room is robbed. The thief gets away with jewels and cash.d. While practicing his chip shot in the yard, Sam accidentally sends a golf ball crashing through the dining room window. Which of the following identifies a criterion needed to become a civil engineer?a masters degree in a specialized fieldprevious government experiencea Professional Engineering licenseexperience with a private architectural firm Check out this square pyramid: Find the surface area of the square pyramid (above) using its net (below). Magnesium is added to dilute hydrochloric acid. This makes bubbles of hydrogen and a colorless solution of magnesium chloride. Write down the name of one of the products of this reaction. Identify whether longhand notation or noble-gas notation was used in each case below.Iron (Fe): [Ar]4s23d6 Could someone please help me solve these? Which process produces genetically identical cells?A. MeiosisB. Mitosis What is 1 1/2 + 2 3/5 ecologically, termites are classified as a carnivore b, detritivores c, insectivore d, herbivore Christian Robbie are construction arytenoids stained glass window whose length is 7.3 inches longer than its width if the area of the window is 596.9 in. find the width and the length Vinegar, which contains acetic acid, is used in foods and has few safety concerns. Hydrochloric acid is used in chemistry labs and requires the use of safety goggles and gloves. Why do the safety concerns for these two acids differ? 2 ... Acetic acid is a weak acid, and hydrochloric acid is a strong acid. Find x. Round to the nearest degree.