please help



will mark brainlist

Please Help Will Mark Brainlist

Answers

Answer 1

its b

Step-by-step explanation:

all the others don't work

Answer 2

Answer:

yea, I think its the second one


Related Questions

Num cinema, há 12 fileiras com 16 poltronas e 15 fileiras com 18 poltronas. O número total de poltronas é

Answers

Responder:

462 assentos

Explicação passo a passo:

Dado que :

Número da linha = 12; Número de assentos por fila = 16

Número de linhas = 15; número de assentos por fila = 18

Número total de assentos para as 12 filas:

12 * 16 = 192 assentos

Número total de assentos para as 18 filas:

15 * 18 = 270 assentos

Número total de assentos:

(192 + 270) = 462 assentos

A teenager has 8 tee shirts, 2 belts, and 5 pairs of jeans. How many different outfits can he wear, assuming that he must wear a belt to keep those pants up and keep that shirt tucked in?​

Answers

Answer: 80 ways

Step-by-step explanation:

If 8 tee shirts can be worn in 8 ways  

similarly for 2 belts = 2 ways

five pair of jeans= 5 ways  

so total number of ways=5*2*8=80 ways

Find the slope of the line that passes through the pair of points (-6,2),(5,-1)

Answers

Answer:

y = -3/11x + 4/11

Step-by-step explanation:

y2 - y1/ x2 - x1

-1 - 2/ 5 - (-6)

-3 / 11

y = -3/11x + b

-1 = -3/11(5) + b

-1 = -15/11 + b

4/11 = b

HI! please help out ASAP this is due today! Explain it the best you can and send a picture explaining it so I won’t get confused. Thank u!

Answers

points are

(0,-1)
(3,-2)
(1,-4)

Let f(x) = x^2
If g(x) is the graph of f(x) shifted up 4 units, write a formula for g(x)
G(x)=?

Answers

G(x)=x^2 +4 is the answer

Ronald is growing 1/3 inch each year. How many years will it take for him to grow 5 inches?

Answers

I believe it’s 15 years (anyone correct me if I’m wrong).

A variety pack of snacks contains 4 pretzel bags, 3 popcorn bags and 3 cheddar cracker bags. What is the probability that someone selects a pretzel bag, keeps it, and then selects another pretzel bag. HELLP PLS

Answers

Answer:

2/15

Step-by-step explanation:

Given that :

pretzel = 4

Popcorn = 3

Cheddar cracker = 3

Total = 4 + 3 + 3 = 10

Probability = Required outcome / Total possible outcomes

Selecting with replacement :

First selection :

P(pretzel bag) = 4 / 10

Second selection :

P(pretzel bag) = 3 / 9

P(2 pretzel bags) = 4/10 * 3/9 = 12 / 90 = 2/15

Help me pls
put them from least to greatest ​

Answers

Answer: -7/10, -0.35, 1/5, 0.95

Step-by-step explanation:

-7/10 =  -.7

1/5 = 0.2

Answer:

From least to greatest, the correct order is [tex]-\frac{7}{10}[/tex], -0.35, [tex]\frac{1}{5}[/tex], and 0.95.

Step-by-step explanation:

Since all negative numbers are smaller than positive, you immediately know that [tex]-\frac{7}{10}[/tex] and -0.35 are smaller than [tex]\frac{1}{5}[/tex] and 0.95. The greater the absolute value of a negative number is, the smaller that number is. Because [tex]-\frac{7}{10}[/tex] is -0.7, which has a greater absolute value than -0.35, this means [tex]-\frac{7}{10}[/tex] is the smallest number, and -0.35 is the second smallest number. Since [tex]\frac{1}{5}[/tex] is 0.2 which is smaller than 0.95, the correct order from least to greatest would be [tex]-\frac{7}{10}[/tex], -0.35, [tex]\frac{1}{5}[/tex], and 0.95.

NEED HELP FAST! The problem should be attached!

Answers

Answer:

(5,5) I think I'm not sure

Step-by-step explanation:

Wanda rode her bike 5km the first day and she rode her bike 10,000m the second day. How many meters, in total, did Wanda ride in the two days?

Answers

Answer:

there are one thousand (1,000) meters in a kilometer. So, 5,000 plus 10,000 is 15,000 meters.

Step-by-step explanation:

Identify the area of a regular octagon with side length 16 cm rounded to the nearest tenth​

Answers

Well the full answer is 1236.08 so just round it
Explanation
The area of a octagon formula
2 x (1 + •2) the side squared
•__ square root
Just substitute it in
2 x (1 + •2) x 256


the radius of a circle is 6.3 yards. the circle's area is about ___ square yards.

use 3.14 for pi and round your answer to the nearest hundredth.​

Answers

Answer:

37.699cm

Step-by-step explanation:

The circumference of a circle can be obtained by using the equation below:.

The dimensions of the rectangular prism shown are given in centimeters. 4cm, 3cm ,1.4cm What is the volume of the rectangular prism in cubic centimeters?

Answers

Answer

V = 16.8

Step-by-step explanation:

Answer: V- 16.8  

Explanation: From K12

I HATE IT

Which expression is equivalent to 5+n?
n - 5. n/5. 5n. n + 5​

Answers

Answer:

n+5

Step-by-step explanation:

This is according to the commutative property of addition. 5+n is n+5 written backwards.

OMG OMG THE MISS IS ASKING ME THIS AUESTION BEFORE MY OTHER CLASSMATE PLS HELP FAST IM CRYING AND SHAKING I CANT TYPE TOO PLEASEEE

Answers

They are the same

Step-by-step explanation:

Explanation: 3/4 and 6/8 are equal

Find the surface area of the regular hexagonal prism.

Answers

Answer:

I think the surface is

Step-by-step explanation:

3.5

What are the approximate values of the missing side lengths in the triangle below?

120 m

404

BC 136m, AB 89m

BC 89m. AB 136m

BC 105m, AB 162m

BC 162m, AB 106m

Answers

Answer:

BC 136m, AB 89m

Step-by-step explanation:

Find the diagram attached

According to sin rule;

a/sinA = b/sinB = c/sinC

From the diagram;

b = 120m

<B = 60degrees

<C = 40degrees

From the sine formula

b/sinB = c/sinC

120/sin60 = c/sin40

csin60 = 120sin40

c = 120sin40/sin60

c = 120(0.6428)/0.8660

c = 77.1345/0.8660

c = 89.06

c = AB = 89m

Get BC;

According to the sine rule

a/sinA = b/sinB

a/sin(180-100) = 120/sin60

a/sin80 = 120/sin60

asin60 = 120sin80

a = 120sin80/sin60

a = 120(0.9848)/0.8660

a = 118.177/0.8550

a = 136.46

Hence a = BC = 136m

find the volume of the prism. write your answer as a decimal.​

Answers

Answer:

161.21

Step-by-step explanation:

a class sold tickets to their school play. each of the 23 students in the class sold 4 tickets. the cost of each ticket was 7 $ how much money did the class earn by selling tickets to the play

Answers

Answer:

$234

Step-by-step explanation:

because they did.....

Answer:

$644

Step-by-step explanation:

1: 23 students times 4 tickets sold each student is 92 tickets sold in total

2: 92 tickets times 7$ per ticket is $644

Hope this helps :P

Jenny sells two types of lanyards, solid color or
striped. She charges more for striped lanyards than
for solid color lanyards. The amount of money, in
dollars, that she collects from selling x lanyards of
one type and y lanyards of the other type can be
modeled by the expression 3x + 5y.
What does the variable y represent in this
situation?
A. The number of solid color lanyards sold.
B. The number of striped lanyards sold.
C. The selling price of one solid color lanyard.
D. The selling price of one striped lanyard.

Answers

Answer: The answer is B. The number of striped landyards sold.

Step-by-step explanation:

Which expression is a factor of 9r^2 - 4r + 1?
F 3r-1
G r- 1
H- 9r- 1
J- There are no real factors.

Answers

9514 1404 393

Answer:

  J- There are no real factors.

Step-by-step explanation:

For quadratic ax^2 +bx +c, the discriminant is ...

  d = b^2 -4ac

  d = (-4)^2 -4(9)(1) = 16 -36 = -20

When the discriminant is negative, there are no real factors.

Answer: there are no real factors

Step-by-step explanation:

Mr.Thomson owns a rectangular property theater is 52 feet long and 35 feet wide. He adds a new triangular property directly behind his existing property. The base length of the triangular property is equal to the length of the rectangular property.

The area of the whole property is 2,600 square feet. Based on the diagram what is the maximum height , in feet , of the triangular property.

Answers

Answer:

C. 30.0ft

Step-by-step explanation:

Pls help ASAP I DO NOT WANT TO GO TO SUMMER SCHOOL.

Answers

Answer:

Question 8: answer is D

Question 7: answer is B

You can tell which one is bigger because the one with a larger box has a bigger IQR :)

You can tell the minimum is bigger by looking at the numbers on the number line

What type of association would you expect to see between the amount of fog in the sky and the distance a pilot can see?
positive association
negative association
no association
not enough information to tell.

Answers

Positive association

A principal collected and recorded math test scores for two groups of students. After analyzing the information for each group, the principal summarized the data on the box plots. Based on the box plots, which statement correctly compares the median test scores for the two groups of students?

Answers

Para comer um pouco mais tarde a gente não tem

HELP! Please!! Juan borrowed 12,00 from his friend eduardo and made an agreement to play him back over 2 years at an annual simple interest of 4% what is the total amount he will pay his friend back over the 2 years

Answers

Answer:

$12,960.00

Step-by-step explanation:

Use the formula A = P (1+rt)

A = (12000)(1+(0.04x2))

A = $12,960.00

Answer:

if the initial amount is 1200 then the answer is 1296

if the initial amount is 12000 then the answer is 12960

the initial number was unclear with the placement of the comma

Step-by-step explanation:

Help if you can!! I really need some good grades or I will fail this and that wont help anything.

Answers

Answer:

26) A

29)D

4) C

Step-by-step explanation:

Hope this helps. Your gonna pass

Please please help!!! Giving brainiest

Answers

Answer:

8.8 ounces

Step-by-step explanation:

3.96 ÷ 0.45 = 8.8

she bought 8.8 ounces of ground coffee

Find sin A.16/12, b.16/20, c.12/20, d. 12/16, I will give branliest!!!, pls help!

Answers

Answer:

B) 16/20

Step-by-step explanation:

sin∅=opposite/hypotenuse

sin∅=16/20

Therefore, your answer is B.

Answer:

(12/16)

Step-by-step explanation:

Dallas put g gallons of gas in his car. If the car holds 21 gallons to begin, which expression tells how much gas was in the car before Dallas bought gas?

Answers

Answer:

21

Step-by-step explanation:

tee hee

Answer:

if you are talking about distance on cars i have provided you with a chart of      different cars prices and the distance they went/ Vehicle Miles per gallon Gas price, per mile

Subaru Outback 21 $0.14

Chrysler Sebring 21 $0.14

Porsche Boxster 22 $0.13

 PT Cruiser   22  |$0.13

\

Other Questions
sub (7x+5)(2x28x+6). The boxing world has many famous fights. I will give 3 options of fights that I would like you to research and give me the history of the fight. When it took place, where, who was involved and why it was so significant. In your own words write a paragraph on the fight you choose. Options1) Thrilla in Manila2) Mike Tyson vs. Evander Holyfield3) Rumble in the Jungle A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include Which of the following could be the number shown on the number line? 6Which of these statements is true?Acceleration in the direction of motion slows you downB.Acceleration in the direction of motion speeds you upCAcceleration against the direction of motion has no effecton your speedDAcceleration against the direction of motion speeds you up Interest groups and political action committees are both types of organizations thatwrite and pass laws at the state and local levels.are not part of the government, but can influence thegovernment.hold debates and town hall meetings to inform voterson major election-season issues.raise unlimited money for political campaigns and candidates. "Master", I said "this sayings had for me."This sentence primarily reflects the role ofA. Dante as PilgrimB. Dante as PoetC. Virgil as guideD. Virgil as teacher Suri makes $15 per hour and gets a weekly bonus of $25. Juan makes $14 per hour and gets a weekly bonus of $50. Is it possible for Suri and Juan to makethe same amount of wages, y, by working the same number of hours, x, in one week?O Yes, because the slopes of the equations are different so the system of equations will have one solution.No, because the slopes of the equations are different so the system of equations will have no solutions.O Yes, because the slopes of the equations are the same so the system of equations will have infinitely many solutions.No, because the slopes of the equations are the same so the system of equations will have no solutions. The area of a rectangle is 20 mm2. If the width is 4 mm, find the length? Can I Sign in for free I'm a student so I don't know how to log in please help me I would appreciate your service thank you! can someone help me with this? Whenever energy appears in one system, A. it must have come from somewhere else. B. it means the system is suitable for creating energy. C. it must be used quickly or it will be permanently lost. D. it means energy creation has outpaced energy destruction. Find the value of x pls help with this 8. Find the complete predicate of the sentence below.A boy and his faithful dog are good companions.are good companionsgood companionsa boy and his faithful dogare(and If you scam me ill scam you b!ch can someone turn sweater weather into a sonnet poem Can someone help me please The recipe makes 1 serving of punch. Sam used 2 cups of pineapple juice to make her punch, how many servings did she make? Use the equation 2/3m = 2 to find the number of servings. 2/3 cup = Pineapple juice1/2 cup = orange juice3/4 cup = Lemon/lime juice1/3 cup = Ginger ale 1) The Output of a computer can be seen onb) Mousea) Monitorc) Keyboard Find the surface area of the prism? HELP I need the steps if possible (No linksssssssssssss)Pls help me~English ~Ill mark brainliest if correct