Plant cells and animal cells were observed under a microscope. The characteristics of two cells are listed below.

Cell A: Has a cell wall
Cell B: Has chloroplast

Which statement about the two cells is correct? (5 points)
Both cells are plant cells.
Both cells are animal cells.
Cell A is a plant cell and Cell B is an animal cell.
Cell A is an animal cell and Cell B is a plant cell.

Answers

Answer 1

Answer:

Both cells are plant cells.

Explanation:

Answer 2
It would be both are plant cells cause animal cells don’t have either of those

Related Questions

Which level of organization involves an organism’s use of the mouth, saliva, teeth, stomach, intestines, liver, and pancreas to break down food?
A. Cell.

B. Tissue.

C. Organ.

D. Organ system.

Answers

Answer:

d

Explanation: i took test

callme 9473242403 0nly g​

Answers

what would we talk about bae?

Answer:

you mean guys or gils hmm

Explanation:

Question 5. Brainliest involved

Answers

Answer:

id say 50 50

Explanation:

Answer:50%

Explanation:

Which of the following improves your range of motion and helps prevent
injuries?
A. A healthy body composition.
B. Strong flexibility,
C. Strong cardio-respiratory endurance.
D. A good sense of balance.
SUBMIT

Answers

Answer:

B. strong flexibility

Explanation:

Being flexible allows your body to move in a fuller range of motion and can help prevent injury because you aren't putting as much strain on yourself.

Marianne is conducting an experiment on homeostasis in paramecium which is a type of single celled organism. Which of these observation

Answers

Answer:

Contractile vacuole is responsible for maintaining the homeostasis in paramecium.

Explanation:

The observation of this experiment is that contractile vacuole is responsible for maintaining the homeostasis in paramecium because the contractile vacuole regulates the quantity of water inside a cell. Contractile vacuole controls the water balance in the body by absorbing and removing the excess amount of water out of the cell. This function of contractile vacuole allows the cells to survive under hypotonic stress that is present in the pond water or any other stressful environment.

what is the mRNA of GAGATTTACCGTAGC

Answers

Answer:

CUCUAAAUGGCAUCG

Leu-Ter-Met-Ala-Ser

Explanation:

this should be correct, in mRNA A codes for U, T codes for A, C codes for G and G codes for C. Hope this helps

T-lymphocytes are created in the bone marrow and then developed in the

spleen.

adenoids.

thymus.

tonsils.

Answers

Answer: I would say it is in thymus.

Answer:

It is thymus, I just did the question and got it right.

A. Red tailed hawks
B. White spruces
C. Red foxes
D. Lynx

Answers

Answer:

Red foxes

Explanation:

The arrow shows the transfer of energy from the shrew to the red fox

Which of the following is NOT an example of a physical change?

Answers

Answer:

Solution : Combustion of Liquefied Petroleum Gas (LPG) is a chemical change. Because it is an irreversible reaction and new products, carbon dioxide and water vapour are formed and lot of heat is also produced during the reaction.

Which of the following best describes why estuaries are important resources? A. They are the world's richest sources of precious metals. B. They are among the most productive types of ecosystems. C. They prevent weathering of rock from slopes and cliffs. D. They help stabilize the global climate.

Answers

Answer:

B. They are among the most productive types of ecosystems.

Explanation:

The estuaries provide migratory birds a place to rest. for example.

Answer:

B

Explanation:

Got it right on the test thingy

Which limiting factor is being displayed when a fox chases after a pika

Answers

Here it is a hope it helped you!

When a blood clot breaks free and blocks a vessel leading to the brain a _______________________ can happen.

Answers

Answer:

a stroke can happen

Explanation:

A stroke can happen, right?

In pea plants, yellow pea color (Y) is dominant over green pea color (y).
What would the phenotype be if the genotype is Yy.

Answers

Answer:

So we know that yellow pea is dominant over green pea

then offspring might be 75% yellow pea and 25% green pea. Since yellow pea is dominant I feel like it will still be Y because its dominant

Sunny makes a poster showing the levels of organization in the human body.


How can Sunny correct his error? Check all that apply.


Arrow A should point to the organ system.

Arrow B should point to the cell.

Arrow B should point to the organ.

Arrow C should point to the muscle tissue.

Arrow C should point to the organ system.

Answers

Answer:

Arrow B should point to the muscle tissue, Arrow C should point to the organ system.

These are the correct answers, have a nice day! :)

Answer:Arrow B should point to the organ.

Arrow C should point to the organ system.

Explanation: i just did it

cohesion is a property water.Which of the following is NOT an example of cohesion

a.water is attracted to the sides of a glass cylinder
b.water strider can walk on water
c.water forming a drop on a penny
d.water molecules are attracted to each other

Answers

Answer:

A po kasi nga kapag ang tubig ay naisalin sa isang baso minsan ang tubig ay dumidikit sa baso tama diba kaya naman ang sagot ay A baka naman brainliest naman jan:)

Water is attracted to the sides of a glass cylinder is an example of cohesion.

What do you mean by cohesion?

Cohesion means sticking together. If your group of friends heads to the lunchroom as a team and sits all together, you're demonstrating strong cohesion.

Cohesion allows for the development of surface tension, the capacity of a substance to withstand being ruptured when placed under tension or stress.

Cohesion refers to the attraction of molecules for other molecules of the same kind, and water molecules have strong cohesive forces thanks to their ability to form hydrogen bonds with one another.

Learn more about cohesion:

https://brainly.com/question/29598400

#SPJ2

Why are dead or weakened viruses used instead of normal viruses to create a vaccine?

Answers

I think its because vaccines are just to help your body learn how to fight off the virus, it’s not to actually give you the virus. Hope this helped!

because dead viruses aren't as effective as dead than "alive"

List all the GENE mutations here.
1. ___________________

2. ___________________

3. ___________________

4. ___________________

5. ___________________

6. ___________________

Answers

base substitutions
deletions
insertions
duplication
missense
repeat expansion

Which of the following changes takes place during the third trimester of a womans pregnancy

A.) the fetus begins to form teeth
B.) the fetus develops toenails,lips, and eyelashes
C.)The mothers uterine contractions begin
D.) the fetus’s hands and feet appear

Answers

Answer:D

Explanation:

The fetus develops toenails, lips, and eyelashes is the change that takes place during the third trimester of a woman's pregnancy.  Therefore, option (B) is correct.

What happens in third trimester?

By the third trimester, which begins around the 28th week of pregnancy and lasts until birth, the fetus has already formed most of its organs and body parts. During this stage of pregnancy, the fetus undergoes significant growth and development. This includes the development of toenails, lips, and eyelashes. Additionally, the fetus begins to accumulate body fat, and its brain undergoes rapid development.

To answer the other options, the formation of teeth begins during the embryonic stage, which occurs in the first trimester. The mother's uterine contractions typically do not begin until labor, which occurs at the end of the third trimester or later. The fetus's hands and feet appear during the embryonic stage, specifically around the 6th week of pregnancy.

Learn more about pregnancy, here:

https://brainly.com/question/28547022

#SPJ7

Research any harmful bacteria and write a short paragraph about it that includes:

* What sickness it causes
* The symptoms that infected patients develop
* How this disease is spread

Make sure you pick a bacteria, not a virus!

please help

i will brainliest and 5 * and 20 points for the best answer

i don't want to see any link as a an answer

if i do you will be reported

Answers

Answer:

Noroviruses are a group of viruses that cause gastroenteritis in people. Gastroenteritis is an inflammation of the lining of the stomach and intestines, causing an acute onset of severe vomiting and diarrhea. Norovirus illness is usually brief in people who are otherwise healthy. an RNA virus of the family Caliciviridae, is a human enteric pathogen that causes substantial morbidity across both health care and community settings, causes vomiting and diarrhea. People of all ages can get infected and sick with norovirus. Norovirus spreads easily! You can get norovirus by accidentally getting tiny particles of feces (poop) or vomit from an infected person in your mouth.

Explanation:

It's a bacteria it's says virus but it's a bacteria

A
B
C
D
Need help PLEASEE

Answers

[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]

Ur answer is D.

Thanks,

Through the process of nitrogen fixation, legumes such as beans or peas have colonies of nitrogen-fixing bacteria attached to their roots. The plants gain nitrates from the bacteria, and the bacteria gain sugars from the plant. Which type of symbiotic relationship occurs between legumes and nitrogen-fixing bacteria?
Commensalism
Mutualism
Parasitism
Predation

Answers

Mutualism is the answer

The following passage explains the relationship between tectonic plates and earthquakes. Which sentence states incorrect information?


Tectonic plates can push together, pull apart, or slide past each other at their boundaries. The edges of tectonic plates are not smooth, so they create friction as they move. When friction is too great for the plates to move, they can become stuck and pressure can build up. An earthquake occurs when pressure that has built up between plates suddenly is released. The buildup of pressure that leads to earthquakes only occurs at plate boundaries.​

Answers

Answer:

earthquakes occur when the edges suddenly become unstuck and slip along a fault

Explanation:

match the following
(i) Stem tuber (a) minerals

(ii) Conditioned Reflex (b) Blue green algae

(iii) Blood Circulation (c) potato

(iv) Pancreas (d) chlorosis

(v) Autotrophs (e) Pavlov's Experiment

(vi) Active transport (f) Insulin

(g) William Harvey​

Answers

Answer:

Stem tuber ---- Potato

Conditioned reflex ---- Pavlov's experiment

Blood circulation ---- William harvey

Pancreas ---- Insulin

Autotrophs ------ Blue green algae

Active transport ---- Minerals

Note: Chlorosis has no matching item in the list. Explanation is given below.

Explanation:

Stem tubers are plants which store their food in their stems. Potatoes are stem tubers.

Conditioned reflex is a reflex is acquired gradually by training in association with specific repeated external stimuli. For example, the Russian psychologist Ivan Pavlov's  performed experiments on conditioned reflex using a dog. He demonstrated that a dog will salivate on the sound of a bell even if there is no food given to it if the ringing of the bell preceded every feeding session of the dog.

William Harvey discovered the circulation of blood and the function of the heart .

The islets of Langerhans found in the Pancreas secretes the hormone, insulin.

Autotrophs are organisms which are able to manufacture their own food, Blue green algae are examples of autotrophs.

Active transport is transport which requires expenditure of energy and occurs against the concentration gradient of the substance being transported. Because the concentration of minerals in the soil are in very low concentration, active transport is used by the root hair cells carrier proteins to move mineral ions across the membrane into the cell against the concentration gradient. ATP hydrolysis provides the energy for this process.

Chlorosis is a disease which appears as the yellowing of leaves in plants and in human a green tinging of the skin which is caused by the deficiency of minerals especially iron and manganese.

Which one is a producer ? Please HURRY

Answers

Answer:

Grass

Explanation:

Grass produce their own food

There are 450 calories in 100 g of trail mix. If you burn 30 calories in 10 minutes of walking, how much trail mix should you eat to replenish the energy you spend walking for 2 hours?

Answers

Answer:

to replenish the energy spent walking for 2 hours, 80g of trail mix should be eaten

Explanation:

Firstly, let us calculate the number of calories burnt in 2 hours

in 10 minutes; 30 calories are burnt

∴ in 1 minute 30/10  calories are burnt = 3 calories are burnt

2 hours = 120 minute

∴ in 120 minutes 3 × 120 = 360 calories are burnt.

Next, let us calculate the amount of trail mix that contains 360 calories

100g of trail mix = 450 calories

450 calories = 100 g

1 calory = 100/450

∴ 360 calories = 360 × (100/450)

=  360 × 0.222 = 80g

∴ to replenish the energy spent walking for 2 hours, 80g of trail mix should be eaten

How does the tRNA-mRNA interaction ensure that the amino acids are added in the correct order?

Answers

Answer:

Only the tRNA carrying the next amino acid in the polypeptide chain has the anticodon that binds to the appropriate location on the mRNA.

This system ensures that amino acids are added to the chain in the correct order. At the beginning of translation, the ribosome and a tRNA attach to the mRNA.

hope it helps!

Please complete the following DNA strands

1. AGGTCCAAGCTCAAATTTCCCC

2. GAAACCCCTTAAACCTTAATTCC

3. GCGCGCGCAAATTTTTCCCATCT

Please complete the following strands using RNA:

1. AGGTCCCAAAGGCCCTTTCC

2. UAAAGGGCCCAGCCCACC

3. CUAAAAGGGGGUUUUAACC

Answers

1) TCCAGGTTCGAGTTTAAAGGGG
2) CTTTGGGGAATTTGGAATTAAGG
3) CGCGCGCGTTTAAAAAGGGTAGT

1) TCCUGGGTTTCCGGGUUUGG
2) AUUUCCCGGGUCGGGUGG
3) GAUUUUCCCCCAAAAUUGG
(Pretty sure)

Landforms are created through destructive forces such as weathering. Which of these is an example of physical weathering? A acid rain. B abrasion. C hydrolysis. D oxidation

Answers

Answer:  C. HYDROLYSIS

Explenation: Chemical weathering occurs when water dissolves minerals in a rock, producing new compounds. This reaction is called hydrolysis. Hydrolysis occurs, for example, when water comes in contact with granite.

Landforms are created through destructive forces such as weathering, so abrasion is an example of physical weathering that is in Option B as the physical weathering is a type of weathering that involves mechanical breakdown.

What is the significance of weathering in the environment?

Physical weathering is caused by physical forces, such as the expansion and contraction of rock due to changes in temperature and abrasion is a specific type of physical weathering that occurs when rock or soil is rubbed against other rock or soil. In physical weathering, rock fragments or particles are carried by water, wind, or ice, and the repeated collisions and friction caused by abrasion can lead to significant changes in the shape.

Hence, landforms are created through destructive forces such as weathering, so abrasion is an example of physical weathering that is in Option B as the physical weathering is a type of weathering that involves mechanical breakdown.

Learn more about the weathering here.

https://brainly.com/question/14426457

#SPJ6

What is the name of the protective sac in which the heart is enclosed?

Answers

Answer:

A fibrous sac called the pericardium surrounds the heart. The sac has two thin layers with fluid between them.

Explanation:

tell me if i am wrong :)

Answer:

the pericardium

Explanation:

YOUR WELCOME!!!

Why are enzymes important for chemical
reactions?

Answers

Answer:

Enzymes greatly increase the reaction rate, or catalyze them.

Explanation:

Without them, many of us would not be alive, because the reactions wouldn't be fast enough!

Other Questions
2. This chart describes several characteristics of human civilizations.(6.04)Characteristics of Human CivilizationsStable Food Supply?Developed Systems of WritingWhich phrase best completes this list?A. Created militariesB. Complex social structuresC. Use of fire for protectionD. Declining population PLEASE HELP IM GONNA FAIL WILL GIVE BRAINLESS On the grid below, draw the graph of y = 2 - 3x for the values of x from - 3 to 3 simplify 20=7z-15 , y+5=29 Parallel Lines cut by a transversal Why is it so important to be able to recognize the logical fallacy called "false cause"?A. Knowing if one event caused another can help you win arguments.B. Understanding cause and effect is only useful in math and science.C. Most events have multiple causes, so finding a true connection between them is impossible.D. Finding the real cause behind events keeps you from being mislead and helps you find real solutions to problems. Write an emergency that could happen that would have a financial cost My name is Julio, and I live in Tegucigalpa, Honduras. My dad's side of the family is Puerto Rican and Cuban, while my mom's side of the family is Portuguese. My friend Petra lives in Florida, United States, and her dad's family is African and Cuban, while her mom's side of the family is Cuban and French.What is similar about Julio and Petra's heritage? (1 point)They both have Cuban ancestry.They both have French ancestry.They both have Italian ancestry.They both have Portuguese ancestry. Type your summary here. Use the Internet to find an article that presents a forecast of the economy's performance in the next three months to a year. Once you have found and read your article, record your summary using the following format in the box below and include the link. Be sure to include the URL links you used as resources in the space below.Paragraph #1 - Summary of article including the link.Paragraph #2 - How it relates to entrepreneurship.Paragraph #3 - Your opinion of whether or not you agree with the prediction and the evidence provided to support the forecast. The graph of linear function g passes through the point (-3,-10) and has a slope of 2.What is the zero of g. Please tell me how much it would be for 1 Can someone plz help me how does high blood pressure affect peoples moods A store sells bottles of juice in boxes. Garth bought 18 bottles, Rico bought 36 bottles, and Mai bought 45 bottles. What is the maximum number of bottles in each box? How do i know this answer to this question ?? Joe has a total of 94 stamps in his stamp collection. He collected 27 in April and 34 in May. How many did he collect in June? The ratio of the vertical change to the horizontal change to any two points on a line is called _______ of the line What is one reason racial inequality has remained a problem in South Africa since the end of apartheid? A. White South Africans control most large farms and businesses. B. Black South Africans have refused to hire any white employees.C. Black South Africans have mostly left the country. D. White South Africans were stripped of nearly all their property. In the book of life of Pi, Pi claims that "repetition is important in training not only ofanimals but also of humans." In terms of training a dog to sit, explain howrepetition works with training humans. * 7. Patty can make 10 purses in 8 hours. Write and solve a proportion to find how many purses can she makein 28 hours. What is 14 percent of 87