Natural selection is a very important part of evolution. Select all of the CORRECT statements below
about the theory of natural selection.
More individuals are produced than can survive
Natural selection favors the strongest and fastest individuals in a population
There is genetic variation in populations
Beneficial traits are passed on to future generations

Answers

Answer 1

Answer:

Natural selection favors the strongest and fastest individuals in a population

Beneficial traits are passed on to future generations

There is genetic variation in populations

Explanation:

I just did this last trimester in natural science.


Related Questions

If a son has a sex-linked disorder, he received it from ______.

Answers

Answer:

tuff

Explanation:

if the son has a sex-linked disorder, the son received it from his mother

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

What is the Florida state lizard (don’t search) just guess

Answers

Its uhm the iguana right?

When identifying the agent responsible for causing a disease, why is evaluation of colony morphology not enough?

Answers

Answer:

Some infectious diseases are distinctive enough to be identified clinically. ... Infections may be caused by bacteria, viruses, fungi, and parasites. ... Microbial Identification: Colony and cellular morphology may permit preliminary ... Diagnostic medical microbiology is the discipline that identifies etiologic agents of disease.

Explanation:

Microorganisms have antigens present on their surface, Antigen tests detect the presence of a microorganism directly so that doctors can diagnose an infection quickly, without waiting for a person to produce antibodies in response to the microorganism.

Evaluation of colony morphology is not enough as it is not a definitive test. colonies of different bacteria can look the same, so it can help narrow.

What is antigen tests?

An antigen test is an immunoassays test used for the detection of a specific viral antigen that indicates current viral infections.

Hence, Antigen tests detect the presence of a microorganism whereas, Evaluation of colony morphology is not enough as it is not a definitive test.

To learn more about the Antigen  click here

https://brainly.com/question/14453511

¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?

Answers

Answer:

La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:

_______ Which vitamins and minerals must be listed on food labels?
a. vitamin D, vitamin C, iron and magnesium
b. vitamin C, calcium, iron and potassium
c. vitamin C, vitamin A, calcium and iron

Answers

I believe the answer is C

4 In your own words, describe the relationship between
the processes and forces that create the different types of rocks

Answers

Answer:The three main rock types are igneous, metamorphic and sedimentary. The three processes that change one rock to another are crystallization, metamorphism, and erosion and sedimentation.

This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism

Answers

Answer:

A. Mutualism

Explanation:

The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.

A.Mutualism. hshshshshs

A father sheep has curly wool while a mother sheep has straight wool. Which of these statements explains why one of their baby lambs has curly wool?

Answers

Answer:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

Explanation:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

OR if the baby sheep received a mixed set of genes , one from father , the other from mother , the gene of the father is dominant over the gene of the mother and it has given the baby sheep curly wool.

During fertilization the baby must have received the same set of genes as those of its father. If the baby has received a mixed set of genes then the genes of the father are dominant over the genes of the mother resulting in curly wool.

The fathers gene may be dominant due to environmental circumstances or other factors.

Answer:

Explanation:The baby lamb inherited its copies of the gene for wool shape from its father and not from its mother. Just like its father’s genes, those genes instruct for proteins that connect in ways that make its wool curly.

Bill Nye Earth's crust

Answers

1. rock
2. on
3. mantle
4. volcanoes
5. active
6. lava
7. hot
8. coolest
9. geyser
10. resistant
11. tectonic
12. tectonic/pangea
13. caves
14. earthquake
15. crust

Answer:

1. rock

2. on

3. mantle

4. volcanoes

5. active

6. lava

7. hot

8. coolest

9. geyser

10. resistant

11. tectonic

12. tectonic/pangea

13. caves

14. earthquake

15. crust

Explanation:

Which process begins the formation of sedimentary rock?

Answers

Weathering breaks down pre-existing rock into particles, while erosion moves the particles to a site of deposition. These processes begin the formation of sedimentary rock. ... Sediment can be moved by wind, running water, ice, or waves.

true or false
Photosynthesis is part of an oak tree's niche.

Answers

Answer:

True, veryyyyy true

:))

mushroom can only be found in dark places . why ?

Answers

Answer:

advantage of growing mushrooms in the dark is that darkness preserves the moisture that mushrooms spores need to reproduc

give an example of something that might stop a cell from checking things during the cell cycle

Answers

Answer:

The death of nearby cells and the presence or absence of certain hormones can impact the cell cycle

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.

A.GL, Gl, gL, gl
B.GG, Gg. LL, Ll
C.GL, Gl
D.GG, Ll

Answers

Answer:

GL Gl gL gl

Explanation:

What phylum does green algae belong in

Answers

Answer:

Phylum Chlorophyta

Explanation:

hope this helps :)

In the mouse model of malaria, the researchers injected Plasmodium-infected human red blood cells into the mice because the Plasmodium species had surface ligand proteins that bound only to cell membrane proteins of human red blood cells. Assume that the researchers noticed that some of the parasites no longer infected human red blood cells but instead infected mouse red blood cells. Predict the most likely cause of this change in the host specificity of the parasites. Plasmodium reproduces both sexually in the host vertebrate and asexually in mosquitoes. The researchers claim that the Plasmodium organisms that infect the two different types of red blood cells are likely to evolve into two separate species of Plasmodium. Based on the biological species concept, provide reasoning that would support the researchers’ claim.

Answers

There is a mutation in the în the genes coding the ligand. They will evolv3 separately in two host species proving the researchers right.

The soil has certain microbes that interact with the roots of plants in a symbiotic relationship. Which organism is harmed from this relationship?

Answers

Answer:

No organisms

Explanation:

This is because the kind of symbiotic relationship between plants root and microbes is mutualism. In this relationship both organism s benefit and non is harmed. The microbes make nutrients available for the root, it increase root permeability and also root metabolism while the roots provide home for the microbes and Al's derives food.

help.................

Answers

Answer:

I would say B.

de-forestation is definitely not the answer. and introducing non native species is usually a big no no for the ecosystem.

Answer:

b

Explanation:

if there is nothing to kill bees with then they wont die.

How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars

Answers

Answer:

b

Explanation:

Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.

The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.  

Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:

DNA is the genetic material of the cell  DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formation  

Thus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.  

Learn more about DNA here:

https://brainly.com/question/264225

When a person loses consciousness due to a head injury from a car crash, the ______ keeps the body functioning by regulating the flow of information between the brain and the rest of the body

Answers

Answer:

Brain stem

Explanation:

I hope this helps


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

Thank you to anyone who answers .

Answers

Answer:

D

Explanation:

Answer:

i think its D but im so sorry if it wrong my second answer would probably be A

Explanation:

i really hope this helps sorry if it doesn't

Which type of muscle is long and striated and contains multiple nuclei?
Smooth Muscle
Cardiac Muscle
Muscle of the Digestive System
Skeletal Muscle

Answers

Answer:

Skeletal Muscle

Explanation:

Answer:

Skeletal Muscle

Explanation:

Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think about
their life cycles. Compare and contrast the life cycles of the four. How do they differ?
es )

Answers

Answer:

Please where's the image of the question

Answer:

B

Explanation:

Both the animal and the plant exhibit stages of growth during their lifetimes. They have what mightbe described as a mature stage. The other two, protist and bacteria do not.

People who have leukemia, cancer that affects white blood cells, are often given Cytarabine. This drug inhibits the synthesis of DNA. Which phase of the cell cycle is most affected by Cytarabine?

Answers

Correct answer is S phase. cytosine into cytosine arabinoside triphosphate is what makes the answer S phase.

Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea

Answers

Answer:

Yes.

Explanation:

Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.

How does air pollution affect human health?
a. Respiratory infections
b. Lung Cancer
c. Asthma
d. All of the Above

Answers

Answer:

The answer for this question is D

d is the correct answer
Other Questions
A square pyramid has a height of 6 meters the perimeter of the base is 40 meters what is the volume? A circular patio has a radius of 4 yards. The patio is expanded so that theradius increases by 2 yards. By how many square yards does the area of thepatio increase? How do you feel about the constitution? Do you agree or disagree with it? 1. You invest $1,000 in a certificate of deposit that matures after ten years and pays 5 percent interest, which is compounded annually until the certificate matures. a. How much interest will the saver earn if the interest is left to accumulate? b. How much interest will the saver earn if the interest is withdrawn each year? c. Why are the answers to a and b different? Find the surface area. Show work. 1. my mom loves watching plays. she ____ to a drama club twice a montha. goes b. is going c. has gone d. go2. the helicopter ____ over the forest when we saw it.a. flew b. was flying c. is flying d. had been flying pls help mee i will give you a brainlist! Find the volume of the cylinder. Round your answer to the nearest tenth.12 in.10 in. How do you write 5.09 104 in standard form? A store pays$76.40 for a bookcase and marks the price up by 45%.What is the new price? what must happen in order for a metaphoric rock to be transformed into a igneous rock Give the relationship between the number of valence electrons in an atom'svalence electron shell and the position of the element on the Periodic Table I need help answering these questions it's from Midsummer Night's Dream How does an economic depression affectemployment? How many liters of ammonia gas can be formed from 24.5 L of hydrogen gas at STP? explain how at least three pieces of evidence support the theory of evolution. Dont put any link or else I wont give brainlist, just answer. Bill is a man ...... is interesting to talk with, but...... stories about himself are soincredible that not many people believe them. A) which/ thatB) who / whoseC) that / whatD) whom / when please help me I want to get a good grade so my mom can appreciate me :D! Which of the following choices is an example of Passive Listening?Oo oodoing homework with the TV playing in the backgroundlistening to the radio while cleaning your roomhearing street noises as your walk to schoolAll of these choices are correct. need help answer all three to get brainliest Use the distributive property to simplify the expression 7 (8x+3). 7(8X+3=