Name the features caused by wave erosion and label them in the order that they would
occur. Write a short description of each feature.
Hint. There are 6 features.

Answers

Answer 1

Caves

Sea cliffs, sea stacks, sea caves, sea arches, handlands, and wave-cut terraces.

one is missing but u can just check it on quizlet

Name The Features Caused By Wave Erosion And Label Them In The Order That They Wouldoccur. Write A Short
Name The Features Caused By Wave Erosion And Label Them In The Order That They Wouldoccur. Write A Short
Name The Features Caused By Wave Erosion And Label Them In The Order That They Wouldoccur. Write A Short
Name The Features Caused By Wave Erosion And Label Them In The Order That They Wouldoccur. Write A Short
Name The Features Caused By Wave Erosion And Label Them In The Order That They Wouldoccur. Write A Short

Related Questions

PLEASE HELPPPPPPP

(Monstro the Goldfish & Epigenetics)

Answers

Answer:

mmmmmmmmmmmmdddddd

Explanation:

ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd

Why is Linnaeus called the father of taxonomy?

He created the classification level called domain.

He developed the modern system of naming organisms.

He explained the steps that led to the formation of a species.

He used more than one common name for the same organism

Answers

Answer:

he developed the modern system of naming organisms

What increases as you move from the surface to the interior of the Earth?

Answers

Answer:

Heat/temperature

Explanation:

"There are three main sources of heat in the deep earth: (1) heat from when the planet formed and accreted, which has not yet been lost; (2) frictional heating, caused by denser core material sinking to the center of the planet; and (3) heat from the decay of radioactive elements." These give the core and a few of the outer layers of the earth more and more heat.

when an experiment shows that two variable are closely related the experiment shows what

Answers

Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.

Explanation:

Why do disruptive selection pressures tend to favor rapid evolutionary changes?

a. They result in sudden gene frequency changes.

b. They eliminate extreme genetic traits.

c. They select for one variation of a genetic trait.

d. They result in environmental adaptation.

Answers

Answer:

The correct answer is a. They result in sudden gene frequency changes.

Explanation:

The evolution of life, its diversity, is reduced to the processes of microevolution or speciation. But not all evolutionary processes in populations end with the formation of a new species. Disruptive selection is a type of natural selection that selects against the average individual in a population. The composition of this type of population would show phenotypes (individuals with groups of traits) of both extremes but with very few individuals in between. Disruptive selection tends to increase intra-population variability and, to this end, favors individuals at both ends of the phenotypic distribution, that is, as a final result there is a break in two different populations, which can lead to speciation.

Answer:

A"They result in sudden gene frequency changes."

Explanation:

just took the test for edg and got it right

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

(GIVING BRAINLIEST) ______________ energy is the total potential and kinetic energy of particles in an object.
Group of answer choices

Chemical

Nuclear

Thermal

Answers

Answer:

Thermal

Explanation:

The total kinetic and potential energy of the particles in an object is called thermal energy.

please answer this!!

Answers

Answer:

mouth coughing out biok sid carbon

Which of the following foods are native to rainforests?
a. papayas
b. mangoes
c. Sugarcane
d. all of the above

Answers

Answer:

on edge here's the correct answer

Explanation:

Answer: It is D)

Explanation:

o
1. Which criteria are used to classify amphibians into orders?

Answers

Answer:

They are classified into three orders: frogs and toads, salamanders and newts, and caecilians.

Approximately 8,100 species of living amphibians are known. First appearing about 340 million years ago during the Middle Mississippian Epoch, they were one of the earliest groups to diverge from ancestral fish-tetrapod stock during the evolution of animals from strictly aquatic forms to terrestrial types. Today amphibians are represented by frogs and toads (order Anura), newts and salamanders (order Caudata), and caecilians (order Gymnophiona). These three orders of living amphibians are thought to derive from a single radiation of ancient amphibians, and although strikingly different in body form, they are probably the closest relatives to one another.

Which of these is an advantage of fossil fuels? *

O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable





Answers

Answer:

reliable

Explanation:

Explanation:

Fossil fuels are a non-renewable resource.

Can someone please help me

Answers

Answer:

carbon dioxide plus water in the presence of light energy to sugar and oxygen

The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.

What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?

An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.

Answers

The question to the above information is;

What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?

Answer;

An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.

Explanation;

-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.

J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:

atoms are spheres of positive chargeelectrons are dotted around inside

Answer:

Its C on edge

Explanation:

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

An example of __ is the color of betta fish. When a RED fish (GG) is crossed with a YELLOW fish (gg), all of the offspring will be a ORANGE color (Gg)

Answers

Answer:

The correct answer is  - incomplete dominance.

Explanation:

In the betta fish, there are different types of colors found in the fishes depends on the alleles present in their gene which follows incomplete dominance. Incomplete dominance is an inheritance pattern where a dominant allele does not mask completely and produce a blend of both alleles if present in heterozygous condition.

In the question, It is stated that when a cross between RED fish (GG) and a YELLOW fish (gg) produce orange color fish as offspring (Gg) which is a mix or blend of both alleles Red (dominant) and yellow (recessive).

6. A characteristic common to both diffusion and active transport is that
the movement of molecules occurs
energy is needed
oxygen is moved across a membrane
O
molecules move from low concentration to high concentration

Answers

Answer:

oxygen is moved across a membrane O, cause the others are untrue.

Gravitational force multiple choice

Answers

Answer:

Option B. The force would be quartered (factor of 1/4).

Explanation:

The gravitational force between two objects can be expressed with the equation:

By analyzing the equation, we can see that if we multiply both m1 and m2 by 1/2, the resulting new F would be lower by a factor of 1/4 (as 1/2 times 1/2 equals 1/4).

Thus the correct answer is option B.

(PLEASE HELP I WILL MARK BRAINLEST) Limestone is a sedimentary rock and marble is a metamorphic rock. Despite limestone and marble having the same chemical makeup, which statement describes why they are classified as different rocks?

They formed at different times.

They were formed from different fossils.

They were formed by different methods.

They formed in different amounts of time.

Answers

Answer:

The were formed by different methods

They were formed by different methods is the statement that describes that limestone and marble are classified as different rocks.Therefore, the correct option is C.

What is limestone?

Limestone is a sedimentary rock primarily made up of calcium carbonate (CaCO3) in the form of the mineral calcite. It is formed from the accumulation of shells, coral, and other debris from marine organisms.

Marble is a metamorphic rock that forms from limestone, which is a sedimentary rock composed primarily of calcium carbonate (CaCO3). It is formed through a process of metamorphism, which involves the transformation of the original rock through heat and pressure over time. Therefore, the correct option is C.

Learn more about limestone, here:

https://brainly.com/question/11726100

#SPJ3

The question is incomplete, but most probably the complete question is,

Limestone is a sedimentary rock and marble is a metamorphic rock. Despite limestone and marble having the same chemical makeup, which statement describes why they are classified as different rocks?

A. They formed at different times.

B. They were formed from different fossils.

C. They were formed by different methods.

D. They formed in different amounts of time.

which is NOT part of the cell theory?

A) all living thing a are composed of cells
B) Cells are the building blocks of germs
C) All cells come from other cells
D) Cells are the basic units of structure and function in living things

Answers

Answer:

B.

Explanation: Hope this helps! ^^


Please help me with these

Answers

those are nucleotides

since all three of them contain deoxyribose (because there's only one hydroxil group) they are DNA nucleotides

the first nucleotide has cytosine as it's nitrogenous base

the second nucleotide has adenine as it's nitrogenous base

the third nucleotide has thymine as it's nitrogenous base

What change to the following molecule's structure would result in a saturated fat?

Answers

Answer:

It needs to gain a Hydrogen atom to eliminate the double bond between the two carbons.  

Explanation:

Unsaturated fat has one or more double bonds in its molecule. Saturated fat has a single bond. If you want an unsaturated fat to become saturated it needs to gain more more hydrogen atoms which will eliminate the double bonds between carbons of the unsaturated fat.

Hope this helped :)  

Why are some theories more widely accepted than others such as the theory of evolution?

Answers

Answer:

Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.

Explanation:

I majored in Biology

1. Energy transfer is inefficient between trophic levels because

A. Molecules are fully digested from each trophic level.

B. Dead organisms and waste are recycled throughout the trophic levels.

C. Organisms within a trophic level are fully consumed.

D. All organisms within a trophic level die.

2. Primary productivity is defined as

A. The rate that plants and other photosynthesis organisms produce organic compounds.

B. The process where green plants and some other organisms convert light energy into chemical energy using carbon dioxide and water.

C. The overall amount of energy captured by plants and other photosynthetic organisms by the chloroplast.

D. The adjusted amount of energy in an ecosystem due to energy use by organisms for respiration.

Thanks if you help, It's highly appreciated. :-)​

Answers

Answer: b dead organisms And waste are recycled throughout the tropic levels.

Explanation:

Answer:

part 2

the rate that plants and other photosynthetic organisms produce organic compounds.

Explanation:

:)

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

A) Group X = Rose ,mango tree,marigold,palm tree

B) This is the answer of group X =Rose ,mango

This is the answer of group Y =Fern ,pine trees

Explanation:

Answer:

jen, from my heart im saying i lu.v u for real

its been almost 5 months weren't having the same old c.hat we used to have.

ik that ur scared to c.hat with  me since the day ur mom caught u

but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u

and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could

i'll be waiting for that moment and i hope u would be too...

still lu.v u :(  .......

17. What causes evaporation?
O Air that is unsaturated with water vapor comes into contact with the surface of the water
O Air that is cooler than the water comes into contact with the surface of the water
O Air that is warmer than water comes into contact with the surface of the water
O Air that is supersaturated with water vapor comes into contact with the surface of the water in

Answers

the answer is the first one

Evaporation occurs when air that is warmer than water comes into contact with the water's surface, hence option A is correct.

What is evaporation?

As a liquid transforms into a gas, evaporation, a sort of vaporization, occurs on the liquid's surface. For instance, a high concentration of the evaporating substance in the surrounding gas significantly slows down evaporation when humidity affects the rate of evaporation of water.

It takes in moisture from garden soil as well as the biggest lakes and seas, and the level of the water will decrease when it is heated by the sun.

Therefore, solar energy, or heat from the sun, is what causes the evaporation process to occur, hence option A is correct.

Learn more about evaporation, here:

https://brainly.com/question/5019199

#SPJ5

PLSPLSPLS HELP ASAP



a scientist discovers that the acidity of a lake increases overtime. at the same time, its population of Minnows grew smaller. when the adicity of the lake return to normal, The Minnow population recover.

In what two ways can the minnow population be used to monitor the Lakes water quality?

Answers

Answer:

In the above case we can understand that,

If the pH of the water increases the population of Minnows decreases.Minnows population can be determined by the acidity of the lake water.Minnows cannot survive in basic water.

Answer:  The answer is "It can be used to identify possible pH changes." and "It can be used as a bioindicator."

Explanation:

I got it right.

list one part of the cell theory in your own words, explain what it means

Answers

One part of the cell theory is that pre-existing cells can form more cells

This means that cells that currently exist are capable of creating more cells, however it’s a slow process

write a short paragraph on hydra​

Answers

Answer:

at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)

Explanation:

Hydra are simple invertebrates, with two layers of body cells. They live in fresh water. Their body is radially symmetric. They have a central cavity through which they take in food and expel waste.

(GIVING BRAINLIEST!!)


James made the following table to compare the common characteristics of planets. Which of the following would best replace X?


A) Asteroids

B) Comets

C) Moons

D) Stars

Answers

Answer: moons

Explanation:

Mars and Neptune both have moons

Answer:

hi answer is moons

Explanation:they have moons :)

Why is weather different from place to place?​

Answers

Answer:

There are differences in climate around the world because of differing amounts of radiation received from the Sun at different parts of the Earth at different times of the year.

Explanation:

Hope this helps :)

Answer:

because according to where they are located, atmosphere brings different weather and temperature, and some places are further away from the sun, just like when it is day in one side but night on the other

Explanation:

Other Questions
For each diagram, decide if y is an increase or a decrease of x. Then determine the percentage. !!! PLEASE PLEASE HELP ME , IVE BEEN STUCK ON THIS FOR SOO LONG. I SERIOUSLY NEED HELP.!!!Using two or more complete sentences, describe how you can find a vector parallel to B = (-2,3) . In the 1920s, all of the following were issues of security concern in the US except?A.)Cold WarB.)Domestic terrorism C.)BolshevismD.)Anarchism PLZ PLZ someone help me Fill in the table using this function rule.y = 3 + 5xX113045 Bring 8/(a-x) to a denominator of x-a 7. Triangles CDE and RST are similar triangles. What isthe length of side CD in triangle CDE?R40 ft.32 ft.20 ft.TS What continent is the Great Wall of chin in Marking brainless (how ever u spell this)! Is it correct to say this or is there a better way of saying, " I dont think she is a native of this country. She doesnt look or sound like someone from this geographical boundary " what is the climax to the wishbone valley 1)what organs make up the organ system , the circulatory system.2)Bone tissue are shown on the left. what is the difference between tissue and specialized cells. Atoms are stationary and don't move when in solid form.FalseTrue Please help me ASAP Ill mark Brainly identify and explain three environmental impacts of current agricultural methods what is the opposite of 7 Evaluate the expression.131 +-5 Who made up the five main special focus interest groups during the reconstruction? A bookstore charges a standard rate for paperback or hardback books. The cost of a paperback book is 4 dollars less than the cost of a hardback book. Recently, one day of sales totaled $1065.10. That day the bookstore sold 51 paperback books and 47 hardback books. Write a system representing this situation. Use the graph to estimate the solution of the system. What does the solution mean in this situation? How much does each type of book cost? Use substitution to verify your solution. Why did many Americans fear Vladimir Lenin and his followers, the communist?