Many scientists would argue that the reproductive system is the most important system in the body. Which of these would best defend that thought?

A) without the reproductive system, a species would not be able to survive
Eliminate
B) the reproductive system is necessary to maintain a strong skeletal system
C) the reproductive system must help filter wastes so the body can remain healthy
D) without the reproductive system, a body would be unable to transport oxygen to all of the cells in the body

Answers

Answer 1

Answer:

b is correct

Explanation:

Answer 2

Answer:

A

Explanation:

we make babies with the reproductive system


Related Questions

explain how gas is compressed into liquid in a gas barrel

Answers

Explanation:

A gas can be converted into a liquid by increasing the pressure & decreasing temperature. So that the condensation occurs. You must also make the molecules closer so that it is a phase change from a gas to liquid. In liquids, the molecules are very near than that of gases.

A gas can be converted into a liquid by increasing the pressure & decreasing temperature. So that the condensation occurs. You must also make the molecules closer so that it is a phase change from a gas to liquid. ... In liquids, the molecules are very near than that of gases.

Food contains a sugar called , which is broken down in a process called cellular . This process uses to break down food molecules and provide energy for cells.

Answers

Answer:

I think it is glucose.i hope this helps!

Explanation:

Answer:

the correct answers are glocose, respiration, and oxygen

Explanation:

i got it right

WILL MARK BRAINIEST!!!! PLZ!!!
Which system of equations is equivalent to the following system?

4x + y = 4
2x + 7y = 28

4x + y = 4
−2x − 7y = 28
4x + y = 4
−8x − 28y = 112
−28x − 7y = −28
2x + 7y = 28
−8x − 2y = 8
2x + 7y = 28

Answers

Answer:

D.

Explanation:

Answer:

D

Explanation:

In guinea pigs, the allele for black fur(B) is dominant over the allele for
brown fur(b), and the allele for short fur (F) is dominant over the allele
for long fur(1). What percent of the offspring of a BbFf x bbff cross will
be heterozygous for both traits?
Select one:

100%
25%
0%
50%

Answers

Answer: 50%

Explanation:

State the three parts of the cell theory.

Answers

Answer:

The three parts of the cell theory are: cells are the smallest unit of life; all cells come from preexisting cells; and living thing is made up of one or more cell.

Which best describes an adaptation that could be found in a fish that lives in a slow-flowing stream?
the ability to attract prey by glowing
extra gills, for oxygen extraction
O the ability to grow larger
extra fat, for warmth​

Answers

Cold blooded animal that  lives its whole life in the water and breathes with gills, lays eggs in the water, has fins and is covered with scales (ex. goldfish)please mark me as brainliest

Answer:

My best guess is B!!! Sorry if im wrong!!!

Explanation:

Hope this help!! <3

1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.

Answers

Answer:

Explanation:

BY USING FOREST WISELY;

It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;

1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.

2) Those trees of the world make up of portion land species by more than forth or fifth portion.

There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as

hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth

Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.

COMMUNITY CONSERVATION;

It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.

These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.

There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as

Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.

The article 'By using Forest Wisely' can be summarised as:

People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem.

The trees produce oxygen and they made up at least a quarter of the world population.

The trees occupy the fourth or fifth portion of the land organisms.

In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die.

The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available.

Trees are required for manufacturing important materials.

The article 'Community Conservation' can be summarised as:

In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating.

The humans occupied the space to practice farming and make houses.

The population of the gorillas was disturbed and diminished.

The hunting of gorillas by poachers was also reduced.

The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife.

Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.

Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.

To know more about forest conservation, refer to the following link:

https://brainly.com/question/16505239

Which of these is a reason why two different people might require different caloric intakes on a daily basis?

Answers

According to the Dietary guidelines for
America, men aged 19 and older should
consume an average of 2.640 calories and
women should consume an average of 1.785.
However, these numbers may vary according
to each person and their way of living. Some
bodies will need more than that and some
other less. that would depend on physical
activities and work among other things.
THANKS!o
COMMENTS

Answer:

the answer is different body efficiencies

Because i had this question before so this is the true and right!

DNA is a molecule that stores____information in the cells

Answers

Answer: instructions

Explanation: trust me

Answer:

genetic

Explanation:

What are the differences between parents and offsprings ?

Answers

Answer:

Offspring is a person's daughter(s) and or son(s); a person's child. While a parent is one of two persons from whom one is immediately biologically descended; a mother or a father.

Answer:

Parents have offspring

Explanation:

Offspring is the result of sexual or asexual reproduction by parents.

Earthworms, small insects, and microorganisms live in the soil and break down dead plants and animals. What would happen to an ecosystem if this process was compromised?
A.
The population of green plants in the ecosystem would increase.
B.
There would be more energy available to consumers in the ecosystem.
C.
The soil quality of the ecosystem would dramatically improve.
D.
The carrying capacity of the ecosystem would be limited.

Answers

Answer: D

Explanation:

Since the Earthworms, small insects, and microorganisms live in the soil and break down dead plants and animals. They end up playing a vital role in the ecosystem, if this were to be compromised nothing good would come form it Disease, competition, predator-prey interaction, resource use and the number of populations in an ecosystem all affect carrying capacity. If Earthworms, small insects, and microorganisms couldn't break down the the dead material and return it to the soil, then surely the carrying capacity would be drastically effected.

A multicellular organism typically begins as a single cell, and then many cell divisions occur to generate the cells of the adult organism. However, these cells are not identical to the original cell, and they are not identical to one another.


What is the most significant cause of cell differentiation in a multicellular organism?

A.
differences in the number of chromosomes per cell
B.
differences in the genetic code used by different cells
C.
differences in the DNA that is copied and distributed among the cells
D.
differences in gene regulation and gene expression among the cells

Answers

Answer:

D

Explanation:

Difference in cell regulation and cell expression. This is embedded in chromosomes which is the blue print of the organism. The chromosomes is like the house plan when you building a house.

The most significant cause of cell differentiation in a multicellular organism is: D. differences in gene regulation and gene expression among the cells.

What is cell differentiation?

Cell differentiation can be defined as a process through which a young, unspecialized cell undergoes various changes in gene expression, so as to become a specialized that is more specific in terms of function.

In a multicellular organism, which is an organism with multiple cells, the most significant cause of cell differentiation is as a result of differences in gene regulation and gene expression among its cells.

Read more on cell differentiation here: https://brainly.com/question/13846411

The water cycle gets its energy from the ___?

Answers

Answer:

the sun

Explanation:

Tracey was learning about structural organization in animals. What level of structural
organization BEST describes an egg?
A. a cell
B. a tissue
C. a system
D. an organ​

Answers

Answer:

A

Explanation:

Egg cell

The level of structural organization which best describes an egg is: A. a cell.

A cell can be defined as the fundamental (basic) structural, functional, and smallest unit of life, that is typically found in all living organisms such as animals.

The structure of an egg is similar to those of cells found in living organism, which are structurally layered with various cell organelles.

An egg shell is selectively permeable because it acts as an outer membrane just like in living cells to prevent unwanted materials from going into the egg.

In conclusion, the level of structural organization in animals cells can best be describe by using an egg.

Read more: https://brainly.com/question/19559847

Can somebody help with those 3 problems please

Answers

Answer:

first one is option A

second one option B

third is26 N

Explanation:

1.the law here is every action has an equal and opposite......

2. only unbalanced forces move objects from rest or of uniform motion

3.net force is the sum of forces ,if forces are in the same direction

hope this helps plz mark me brainliest

2) Option A.
Force is directly proportional to the mass. As the mass of the fuel deceases as the fuel is burnt, the force also decreases as force is directly proportional to mass, and as the force decreases, the acceleration decreases as acceleration is also directly proportional to the force, and the shuttle may eventually come to a stop due to the increasing deceleration. However, initially if the forces are kept balanced as the space shuttle and the gases exert an equal amount of force on each other in the directions opposite to each other, the object will keep on moving upwards in a constant velocity as the amount of force is also kept constant.


3) Option B.
The motion will definitely change when the forces acting on an object are unbalanced-it will start to move, accelerate or decelerate or change its direction in the direction of the net force. The object will not move at all or continue moving with the same velocity and in the same direction if the forces acting on it are balanced or zero.

4) When the forces are unbalanced and are acting on an object in the same direction, the net force will be found by finding the sum of those forces.
Net force=17+9=26 N.

I really, really hope this helps! And please mark it as brainliest.

burning fossil fuels, it makes the Earth colder.
What percent of the atmosphere is carbon dioxide?
A.4%
B.0.4%
C.40%
D.0.04%

Answers

Answer:

B i took the test

Explanation:

Answer: D

Explanation: Only 0.04% of the atmosphere is carbon dioxide.

which two technologies use reflected sound waves

Answers

Answer:

one of them is SONAR

Explanation:

Other one is megaphone

Answer: There are 3 of them that are: radar, sonar and lidar.

Explanation: I used google to answer this


The landform pictured above is _____, which has formed out of _____ and _____.
O A. a glacier, snow; ice
B. a glacier; ocean water, snow
O C. a mountain; snow; ice
OD. an iceberg; ocean water, snow

Answers

Answer: a glacier; snow; ice

Explanation:

Just did it and it was right

Which sex cell is produced in males?

Answers

Answer:

Sperm

Explanation:

Answer:

Sperm

Explanation:

A virus is ________ a cell.

A)bigger than
b) the same size as
C)smaller than
d)another word for

Answers

Answer:

smaller than

Explanation:

But they're nothing compared to the giants of the cellular world. ... And viruses are smaller again — they're about a hundredth the size of our cells. So we're about 100,000 times bigger than our cells, a million times bigger than bacteria, and 10 million times bigger than your average virus

Hope this helps <3

I need to list the order of traits from sponges to mammals in which they appear from an evolutionary standpoint. I don't know how to find the correct order

Answers

Answer:

please put a picture of the work you have to do so i can help you

Explanation:

The pattern of natural selection where BOTH of the extreme versions of a trait are more advantageous than the average, so a population evolves in both directions away from the average.

Answers

Answer:

Stabilizing Variation.

Explanation:

This is the type of variation that occurs when genetic diversity decreases as the population of organism in a particular population based on a specific trait.

Organisms with varied or specific  traits within the population are selected against by the selection pressure,  with little chances of reproduction, while organisms in between, ( with least variation of  this particular traits) which are within the narrow range, survive to reproduce.Thus, this gives  rise to narrow population  of these  particular organisms,(stabilizing variation) which are therefore naturally selected.

Therefore, the variation of the organisms in this population is kept  close to the  centre of  the same  mean value.

All living organisms are composed of what?​

Answers

All living organisms are composed of one or more cells.So, your answer would be Cell.

hope it helps!


Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Answers

The answer is DNA I know because I know

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

A factory that has not followed pollution control standards has been operating in an area that did not have such a factory before. Plants that used to grow well are not doing well. Fish in a nearby river are dying at a higher rate than usual. Why?

A Pollution from the factory is getting into the rain, which is making the pH levels in the soil and water rise.

B It hasn't rained enough and the plants aren't getting enough water.

C The factory has increased the temperature in the area.

D Pollution from the factory is getting into the rain, which is making the pH levels in the soil and water become lower.

Answers

Answer:

D

Explanation:

If the pH levels are becoming low then the water and dirt becomes acidic killing fish and plants

Which answer choice correctly lists the flow of food through the GI tract (gastrointestinal tract) of the digestive system?

mouth-- stomach-- small intestine-- large intestine-- rectum

rectum-- large intestine--- small intestine--- stomach--- esophagus-- mouth

mouth-- esophagus-- stomach-- small intestine--- large intestine--- rectum

mouth-- stomach-- small intestine-- esophagus--- large intestine-- rectum

Answers

This is hard ........!!!!!!

Answer:

mouth--esophagus--stomach--small intestine---large intestine---rectum

Explanation:

What is the role of DNA in an organism ? how is dna related to reproduction​

Answers

Answer:

DNA plays a role in the growth and reproduction of organisms.The function of DNA is to store all of the genetic information that an organism needs to develop, function, and reproduce.DNA contains the instructions needed for an organism to develop, survive and reproduce. 

A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?

A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left

Answers

Answer:

Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30

F=ma.

30=30a

a=30/30

a=1m/s^2

Germination will not happen unless a seed

A. is dispersed far from the plant that produced it.
B. absorbs water.
C. uses its stored food.
D. grows stamens and a pistil.

Answers

I think it’s B. Absorbs Water

Place the appropriate terms into the table

Answers

Answer:

Kindly, provide us with a table, thank you! :)

Explanation:

Can we see the table lol? :)
Other Questions
in paragraph 7, the last sentence states, tattoos further Away from the heart are also harder to remove because circulation is poorer. why do you think this makes tattoos harder to move using laser removal techniques? Anthony has a combination of 104 nickels and quarters totaling $22. Which system of linear equations can be used to find the number of nickels? how do electric and magnetic fields interact to create electromagnets? cual es el escenario donde acontecen los hechos?? cazador de tesoros - What does X represent for this transmutation?96242Cm+X98245Cf+01n gamma +10e 24He 10e Triangle ABC is rotated 180 using the origin as the center of rotation.On a coordinate plane, triangle A B C has points (negative 4, negative 3), (negative 5, negative 2), (negative 3, negative 2). Triangle A prime B prime C prime has points (4, 3), (5, 2), (3, 2).Which sequence of transformations will produce the same result? aa reflection over the x-axis and then a reflection over the y-axis ba translation up 4 and then a translation right 6 ca translation up 4 and then a reflection over the y-axis da translation right 6 and then a reflection over the x-axis plzzz help will mark the brainliest Can someone please help me? I keep losing points...CORRECT ANSWERS ONLY PLEASE!!!!Use the formula i = prt, where i is the interest earned, p is the principal (starting amount), r is the interest rate expressed as a decimal, and t is the time in years.Round your answer to the nearest dollar. How do developed countries maintain an advantage over developingcountries in international trade? Which word in this sentence is the verb phrase? Some visitors may find the walk difficult. "This is going to be a wonderful place for birds. I shall goto bed now. I say, let's go and explore tomorrow. Youmight find anything in a place like this. Did you see thosemountains as we came along? And the woods? Theremight be eagles. There might be stags. There'll be hawks.""Badgers!" said Lucy. "Foxes!" said Edmund. Rabbits!"said Susan- The Lion, the Witch, and the Wardrobe,C. S. LewisWhich sentence best states the theme of thispassage?Being somewhere new expands people's ideas ofwhat is possible.Sometimes you cannot find something when youare looking for itThe scenery in the city is very different from thescenery in the country.Freedom is more important than anything else inlife. Read the excerpt from President John F. Kennedys inaugural address. Which statement best describes the main message of the passage?In your hands, my fellow citizens, more than in mine, will rest the final success or failure of our course. Since this country was founded, each generation of Americans has been summoned to give testimony to its national loyalty. The graves of young Americans who answered the call to service surround the globe.Now the trumpet summons us againnot as a call to bear arms, though arms we neednot as a call to battle, though embattled we arebut a call to bear the burden of a long twilight struggle, year in and year out, "rejoicing in hope, patient in tribulation"a struggle against the common enemies of man: tyranny, poverty, disease and war itself.And so, my fellow Americans: ask not what your country can do for youask what you can do for your country.My fellow citizens of the world: ask not what America will do for you, but what together we can do for the freedom of man.A. War is the only way to solve the problems of the world.B. People should work together to better their society.C. Americans are incredibly loyal to their country.D. The US government should help those in need. who was the most prominent American official to vist NK, prior to president trump What is the pH of a 1.4 M pyridine solution that has Kb = 1.7 10-9? The equation for the dissociation of pyridine is C5H5N(aq) + H2O(l) C5H5NH+(aq) + OH-(aq). What is the pH of a 1.4 M pyridine solution that has Kb = 1.7 10-9? The equation for the dissociation of pyridine is C5H5N(aq) + H2O(l) C5H5NH+(aq) + OH-(aq). 4.31 9.69 8.72 10.69 What is the equation of a line with a slope of 6 and y intercept of -2 In performing accounting services for small businesses, you encounter the following situations per taining to cash sales. 1. Poole Company enters sales and sales taxes separately in its cash register. On April 10, the register totals are sales $30,000 and sales taxes $1,500. 2. Waterman Company does not segregate sales and sales taxes. Its register total for April 15 is $25,680, which includes a 7% sales tax. Prepare the entry to record the sales transactions and related taxes for each client. Sara goes on a slingshot ride in an amusement park. She is strapped into a spherical ball that has a radius of centimeters. What is the volume of air in the spherical ball? Use this formula: , where r is the spheres radius.A. B. C. D. PLEASE HELP ME ASAP I WILL GIVE YOU BRAINLIEST TO THE FIRST PERSON WHO ANSWERS CORRECTLY- find the value of Y On May 3, Zirbal Corporation purchased 4,500 shares of its own stock for $36,000 cash. On November 4, Zirbal reissued 800 shares of this treasury stock for $7,200. Prepare the May 3 and November 4 journal entries to record Zirbal's purchase and reissuance of treasury stock. What impact does the repetition of the word "some" in line 62, line 63, and line 65 have on the poem's tone? It creates a curious tone, as the speaker wonders which path the immigrants will take in their liv