Answer:
D. A silent variant near the 5' end of the TBX1 gene.
Explanation:
TBX1 gene is wild type human being. It gives instructions for making protein called T-box 1. It plays an important role in tissue formation and organs during embryonic development.
Which of the following are structures of the
lymphatic system? Check all that apply.
Heart
Bone Marrow
Thymus
Spleen
Blood Vessels
Tonsils
Adenoids
Answer:Bone Marrow
Thymus
Spleen
Explanation:Bone Marrow
Thymus
Spleen
The following are structures of the lymphatic system -
Bone MarrowThymusSpleenTonsilsAdenoidsThe lymphatic systemis a network of tissues, vessels, and organs.these structures work together to move a colorless, watery fluid called lymph back into your circulatory system (your bloodstream).The lymphatic system has the following structures:lymph nodes,spleen,thymus the lymphatic tissue found in the small intestine (Peyer's patches)adenoid tonsils,palatinetubal tonsilsThus, the following are structures of the lymphatic system -
Bone MarrowThymusSpleenTonsilsAdenoidsLearn more:
https://brainly.com/question/16074605
animal cell vs plant cell
Answer:
animal cell
Explanation:
The only Purple Animal is the South African____?
Answer:
Okapi
Mark Brainliest
okapi...
hopr helps uh
..yhnk my ansr
Write an experiment to show that sunlight is necessary for photosynthesis.
Answer:
Explanationwe have two or three plants, they both get the same water every day they both get the same amount of soil and fertilizer, one is without sunlight and one is with, after a 2 weeks our results will be found
hope this helps
Differentiate between pathogenicity and hypersensitivity; Also write different methods of inoculating the plants.
Answer:
As nouns the difference between pathogenesis and pathogenicity. is that pathogenesis is the origin and development of a disease while pathogenicity is the quality or state of being capable of causing disease.
What fraction of the progeny of the cross BbTt x BbTt will have black fur and long tails?
A) 0/16
B) 1/16
C) 3/16
D) 9/16
E) 16/16
Answer:
plzzzz upload a full picture
How does water relate to the ability of a living thing to generate usuable energy?
Answer:
Without the proper balance of water, chemical reactions in cells could not take place.
Explanation: :)
The suprachiasmatic nuclei enable the nervous system to respond to daily light/dark alterations through their stimulation of
Answer:
The suprachiasmatic nuclei enable the nervous system to respond to daily light/dark alterations through their stimulation of melatonin.
Explanation:
Melatonin is a hormone produced naturally by the body. Its function is to regulate the body's circadian cycle. This hormone is stimulated and begins to act by changing between a light environment and a dark environment. This stimulation interacts with the suprachiasmatic nuclei making the nervous system understand this change and luminosity of the environment and respond to the action of melatonin.
The species Trichonympha ______________. Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a may be isolated from the gut of termites where it is essential for cellulose digestion b is a ciliated organism c is a flagellated organism d both a and b e both a and c
Most streams result from _____.
a. altitude
b. melted snow
c. oceans
d. rivers
Answer:
....b........ melted snow
Which of these is a benefit of fish farming?
A. It can deplete native fish populations
B. It can restock lakes depleted by recreational fishing
C. It can pollute natural bodies of water
D. It can pass diseases to native fish populations
Answer:
The answer to this would be B
Explanation:
B:It can restock lakes depleted by recreational fishing
In the diagram below, which part of the human brain coordinates balance, movement, and other muscle functions so that the body moves smoothly? A B C
Answer:
c
Explanation:
c is the cerebellum
b is the spinal chord
a is parietal lobe
why do males and females have different signs and symptoms when it comes to heart attacks
[tex]{\huge{\underline{\sf{\red{Answer}}}}}[/tex]
For men and women, chest pain or discomfort is the most common heart attack symptom, but women are more likely to report shortness of breath, back or jaw pain, and nausea and vomiting. Black women of any age have a higher incidence of heart attacks than white women.
do you think there is the roots in utricularia?
Answer:
I think so
Explanation:
State three ways of increasing the life-span of cut flowers
Answer:
Clean your vase thoroughly, Keep flowers away from fruit, Flower Food and Water
Explanation:
Should we clone animals that are going or have gone extinct (in other words bring them back
either from the brink of extinction or from extinction)? Explain your answer.
Answer:
I think we should but people are preventing this though
Explanation:
I think we should because it might benefit the world and let scientists to discover this animal. But then I don't think so because animals that are/were extinct could perhaps be from climate change. Nowadays, people don't take this matter seriously causing habitats to be destroyed and animals to be extinct :) Like icebergs are melting that mean penguins are at risk of being extinct,if we did something then this situation will be prevented. However dinosaurs did become extinct and they did not come back so its probably just life and this is how god planned it:)
does tomato have thick or thin exocarp?
Which quantity does a light year measure
Answer:
distance = 9.46 trillion kilometers
Explanation:
Light years measure distance and is a unit that equals the distance light travels through space in one year on Earth (365 days) and is used as way to measure extremely vast distances in outer space. It equals 9.46 trillion kilometers.
2 True or False. A projectleie an object that once set in motion continues in motion by its own martia O True False
Answer:
The answer is true.Explanation:PARTICLES MOVING ALONG THE PATH POSSES A TWO DIMENSIONAL MOTIONMARK ME AS BRAINIST PLZ
Consider the following statements:
1. RNA is ribonucleic acid.
2. RNA is used for information transport (known as mRNA). Choose the correct answer from the given codes:
A Only 1
B Only 2
C Both
D Neither 1 nor 2
E None of the above
Answer:
Only A
Explanation:
RNA is used for storing and transporting information through mostly virus only..
Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!
Complete question:
Use the sequence below to answer the following questions
3’-ACGGATCCTCCCTAGTGCGTAATACG-5’
5’-TGCCTAGGAGGGATCACGCATTATGC-3’
1. Enter the sequence of the coding strand with a 5’-3’ polarity
Answer:
coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´
Explanation:
When referring to the coding strand, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.
The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.
When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.
The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.
Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.
So, in the exposed example we have two strands, but we do not know yet which one is the coding one.
Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.
First-strand:
3’-ACGGATCCTCCCTAGTGCGTAATACG-5’
let us write it is 5´to 3´direction
5´- GCATAATGCGTGATCCCTAGGCA -3´
now let us identify the start and stop codons in 5´⇒3´direction.
Start codon ⇒ ATGStop codon ⇒ TAA, TAG, TGA5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning
5´- GCATAATGCGTGATCCCTAGGCA -3´ ⇒ 3 Stop codons
Second strand: We will do exactly the same procedure
5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 start codon near the end
5’-TGCCTAGGAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning
What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.
So, the sequence of the DNA coding strand with a 5-3 polarity is
5´- GCATAATGCGTGATCCCTAGGCA -3´
14.
(GT.03)
Which of these best matches a source of information with its most reliable use? (2 points)
cladogram → date events which occurred in Earth's past
cladogram → study the evolution of organisms based on adaptations
fossil records → compare the evolution of completely soft-bodied organisms
fossil records → study the behavior of primitive animals in extreme weather conditions
Answer:
petrified fossils → date sedimentary rocks
Describe the impact of technology on the environmental today
Explanation:
Other detrimental effects include diseases such as typhoid and cholera, eutrophication and the destruction of ecosystems which negatively affects the food chain. Resource depletion is another negative impact of technology on the environment. It refers to the consumption of a resource faster than it can be replenished
The extinction vortex represents the idea that even if an organism is extant, it may have a gene pool that will not support its long-term survival.A. TrueB. False
Answer:
True.
Explanation:
Extinction vortex is a model used by scientists to understand extinction dynamics within a community. This model allows scientists to assess and understand how a population can become highly vulnerable to elements of its habitat, becoming increasingly apt for extinction. According to this model, any organism is capable of extinction, as all are susceptible to having a gene pool that will not allow its survival, regardless of the environment.
What are the best management practices for Maize grain crop, by adopting which we can boost yield, elaborate in details your expert opinion.
Answer:
Cultivate prime grain and with timely care
At a birthday party, a teen decides to inhale some of the helium from a nearby balloon using his mouth. Before the helium gas reaches his right and left lungs, through which order of structures will it flow?
A. Oral cavity to the oropharynx to the trachea to the right and left main bronchi.
B. Oral cavity to the trachea to the trachea to the nasopharynx to the right and left main bronchi.
C. Oral cavity to the right and left main bronchi to the trachea to the oropharynx.
D. Oral cavity to the trachea to the larynx to the right and left main bronchi.
E. Oral cavity to the nasopharynx to the trachea to the right and left main bronchi.
Answer:
D. Oral cavity to the trachea to the larynx to the right and left main bronchi.
Explanation:
The respiratory system may be a system consisting of specific organs and structures used for gas exchange in animals and plants.
What is the process of respiration?We have a pair of external nostrils opening out above the upper lips. It results in a nasal chamber through the nasal passage. The nasal chamber opens into the pharynx, some of which are the common passage for food and air. The pharynx opens through the larynx region into the trachea.Trachea is a straight tube extending up to the mid-thoracic cavity, which divides at the extent of the 5th thoracic vertebra into a right and left primary bronchi. Each terminal bronchiole gives rise to a variety of very thin, irregular-walled, and vascularized bag-like structures called alveoli. The branching network of bronchi, bronchioles, and alveoli comprise the lung.
Thus, we can conclude that the correct option is (e).
The oral cavity to the nasopharynx to the trachea to the right and left main bronchi.
You can learn more about the respiratory system here:
https://brainly.com/question/2619922
#SPJ2
who do study edexcell certificate level? and can help be physics,chemistry and biology exam
I have done GCSE sciences and also applied science a level so I could probably help you :)
Which genotype would give you a wild type phenotype?
Answer:
C
Explanation:
What is the purpose of a geological time scale ?
It used to predict natural disaters throughout Earth’s history.
It is used to present the correct sequence of events in the Earth’s history.
It is used to determine the absolute dates in years for different periods.
It used to create a naming system for flora and fauna.
Answer: B. It is used to present the correct sequence of events in the Earth’s history.
Explanation: On Edge!!!! :)
Answer:bbbbb
Explanation:
qcw3ec
If a diploid cell has 20 chromosomes, how many sister chromatids will be present
during PROPHASE of MITOSIS?
Answer:
92 chromatids
Explanation:
During phosphate, the nuclear envelope of the cell (which is where the 92 chromatids are contained) begins to break down. The centrioles, which are the only present in animal cells, separate and each moves to an opposite end of the cell