List the social institutions in the african environment. Describe their basic function and show their connection to development​

Answers

Answer 1

Answer:

These diverse social institution examples illuminate the concept! These institutions are a part of the social order of society, and they govern the behavior and keep reading for the five main social institutions found in all human groups​, as well as other how each state functions depends on the type of government it has.


Related Questions

True/False
7. Advertisements simply mirror, rather than shape, consumer preferences and values.
8. "Helps," "fights," and "up to" are common weasel words.
9. Ads that play on our fears and insecurities are known as anxiety ads.
10. Feel-good ads are used to appeal to certain images people have of themselves (as competent or responsible, for example).
11. The news media tend to extract information from the wider context, leaving us with some facts but little knowledge.

Answers

7 false (I think)
8 true
9true
10 no clue
11 true

how a positive personal lifestyle plan may promote meaningfulness of life​

Answers

Answer:

You may feel positive, and not a sad person. You may feel more energetic to do things, like clean your house or something. You will/would have more motive.

Explanation:

Positive personal life refers to a positive attitude and action towards life. It improves the quality of life and sets up milestones.

Positive Lifestyle Brings Meaningfulness to Life

A positive lifestyle is necessary to overcome failures and accept the opportunities to enhance the quality of life.

A positive lifestyle also refers to exercising, focussing on the diet, and doing yoga to sustain peace of mind to reduce workload and stress.

A positive lifestyle brings happiness, satisfaction, and courage to explore opportunities and deal with failure positively.

Thus, a positive lifestyle brings a positive attitude towards life and meaningfulness to set milestones.

Learn more about a positive lifestyle, refer here:

https://brainly.com/question/951060

Topic sentence for Why did the north win

Answers

Answer:

The North was more industrial and produced 94 percent of the USA's pig iron and 97 percent of its firearms. The North even had a richer, more varied agriculture than the South. The Union had a larger navy, blocking all efforts from the Confederacy to trade with Europe.

Explanation:

Which of the following distinguishes autobiographical memory from general memory The importance of rehearsal The role of emotion in shaping autobiographical memory may be less applicable to other kinds of memory. The formation of generalized schemata from individual memory episodes. The potential for intrusion errors and susceptibility to misinformation.

Answers

The correct answer is the following.

The statement that distinguishes autobiographical memory from general memory is "The role of emotion in shaping autobiographical memory may be less applicable to other kinds of memory."

We could say that autobiographical memory is the way individual events are stored in our brain. It is the memory from which we can retrieve the most important memories in our life. It includes knowledge, experiences, and moments -good or bad- that have marked our life on Earth.

That is why emotions are an important component of this memory. Because emotion imprints a special component so we can find it relatively fast for the feeling it produces us when remembering that event.

Enumerate some of the values your family holds dear. In what ways do these values affect your lifestyle as a teenager?
In 10 sentences

Answers

Some ideas for values
Your religion (If your religious)
Any holiday traditions
Favorite foods to make
Special items in your house
I don’t know if this helped but good luck!

Why was the Soviet Union so interested in Afghanistan

Answers

Answer:The Soviets Upheld the 'Brezhnev Doctrine'Even Dubček's modest steps away from hardcore communism offered reason enough for the Soviets to invade Czechoslovakia and abduct him. By 1979, Afghanistan, a faltering, once-friendly regime, provided another chance for the USSR to militarily enforce the Brezhnev doctrine.

Explanation:

decide which person should get the kidney and why!! for economics.

Answers

Answer:

not sure.

Explanation:

hope you find a solution!

Answer:

#4

Explanation:

if he continues to fight for the rights of poor people, he can continue and even maybe get the other people the help they need. he still has a few decades to live, he could do a lot in that time.

As a Senior High school student, what are the basic concepts that we need to learn
for us to understand what is happening around us particularly those that occur in our
society?



pa help po ​

Answers

Empathy, to be able to connect and understand the issues a peer may be facing.

Eloquence, to speak up about injustice and be respectful while speaking.

Silence, to know when to let others speak, and to know when to keep words to oneself.

As a senior secondary student, the basic concepts to learn to understand things happening around us are observation and empathy

The world keeps changing every day, the same as people and how things are done. To understand what is happening around them, today's High school students would have to put the following into consideration;

-> Observation: this is the ability to take note of events and happenings in an environment. it involves a lot of detailing as the individual involved would have to put in some time and monitoring to get what he wants.

-> Empathy: Observation is really good but empathy has a big role it plays when considering details. Empathy is the pathway to observation, if there is no empathy(consideration), the individual would not be observant.

Today's high school students can only know what's happening in their environment when they have empathy and can observe details after considering them.

For more click; https://brainly.com/question/22647054

What is the correlation between a tax rate of zero and a tax rate of 100% government?

Answers

Answer:

The correlation between a tax rate of zero percent, and a tax rate of 100% is that in both cases the government would collect exactly zero taxes.

Explanation:

The reason for this at the 0% rate is self-explanatory: if the government does not impose any taxes, it will obviously collect zero tax revenue.

However, the explanation for this case at the 100% is a bit more elaborate. At a 100% tax rate, incentives to work and earn income would radically change. In other words, people would have no incentive to do so because the government would charge a tax for 100% of their income. For this reason, they would either abandon employment, or find ways to avoid the tax. This would eventually result in zero tax revenue for the government.

What are the roles and duties of the secretary of the Senate? Check all that apply.

maintaining all Senate documents
ensuring that procedures and rules are followed
setting meeting times for senatorial secessions
keeping a journal of all events that take place in the Senate
assuming the duties of the Senate president in the event of absence, death, or disability

Answers

Answer:

maintaining all Senate documents

ensuring that procedures and rules are followed

keeping a journal of all events that take place in the Senate

a b d

Explanation:

PLEASE MARK BRAINLIEST!!!!!!!!!!!!!

Answer:

maintaining all Senate documents

ensuring that procedures and rules are followed

keeping a journal of all events that take place in the Senate

Soils form most effectively in cold, dry climates A.True b.False

Answers

Answer:

b. False.

Explanation:

Soil formation occurs as a result of the the decay or the remains of plants and animals which are used up.

Weathering can be defined as the physical and chemical breakdown of rock into smaller pieces called sediment. Weathering can be classified into two categories namely;

I. Physical weathering : it is the process of breaking rocks into pieces without affecting its chemical composition e.g temperature, abrasion and frost action.

II. Chemical weathering : it is the process of breaking rocks into pieces by chemical action which leads to changes in its chemical composition e.g carbonation, hydration, plant acid and oxidation.

Generally, soils form effectively in warm, moist climates than in cold, dry climates.

Two ways in which women and children can be protected from discrimination and violence

Answers

First there must be public education to the general public to enhance or talk on there effects on discrimination and violence
Also, there must be law enforcement,which will be used against anyone who plays someone as a victim

The two ways that women and children can be protected from discrimination and violence are:

Creation of laws that prohibits such activities.Sensitizing the public.

What is discrimination?

This is the bias against people due to the fact that the person thinks that they are inferior or they are not up to their standards.

Women and children have been subjects of discrimination for a very long period of time. They have also being targets of violence due to the fact that they are considered the weak gender.

Read more on discrimination here:https://brainly.com/question/1084594

Please develop a two-page case write-up that includes the following three elements:
1. Problem statement
Define the problem that Haier faces and that you address in the write-up; conclude the first paragraph with the question and explain why the question is important.
2. Analysis
Keep focused on the question raised; indicate factors that are important for answering the question and discuss the relationships between them.
3. Recommendations
Offer recommendations for Haier that should follow logically from your analysis; discuss implementation issues.

Answers

Answer:

Higher wage of labor and cost of production.

Explanation:

Higher wage and cost of production are the problems faces by Hair because due to higher cost of production, the cost of Hair appliances are also very high which lowers its demands, while on the other hand, Whirlpool launches appliances that has low cost than Hair appliances so people go for Whirlpool appliances which is a big problem. The solution of this problem is that the Hair company shift their set up in that country where wages are low as well cost on production, in this way the Hair can solve its problem.

Please help me i need the right answer fast and please dont guess thanks <3

Answers

Answer:

The answer to this question is True

Yes ,,, because population density its the number of people per unit area ie how many people are in an area

Tristan joined a local land conservation advocacy group because he cares passionately about protecting green spaces. Through his involvement in the group, he became friends with a number of the members. He began spending time with them outside of group meetings and events, getting drinks after work and going on hikes on the weekends. This is an example of which of the following?

a. a reference group becoming a secondary group
b. a reference group becoming a primary group
c. a secondary group becoming a primary group
d. a primary group becoming a secondary group

Answers

Answer: c. A a secondary group becoming a primary group.

Explanation:

The example above signifies a secondary group becoming a primary group. A primary group is a group whereby an individual shows love, support or concern towards others in the group e.g family, church groups etc. The relationships formed here are usually long lasting.

Secondary groups on the other hand are the large groups whereby members typically have impersonal relationships. Since Tristan later became friends with a number of the members and they spent times together, this shows that a secondary group becoming a primary group.

How did the oil industry impact the railroad industry

Answers

The oil industry helped the railroad industry expand. With crude and refined oil needing to be transported in large quantities, trains were an efficient method to transport across long distances. The railroad industry was able to open thousands of miles of tracks to reach all corners of the country.

Most Latin Americans live in big cities. These Urban areas are mostly found where?

A.
Deserts

B.
Mountain Ranges

C.
Forests

D.
Coasts

Answers

Answer:

Coasts

Explanation:

People need a water source to live this is why there are more cities in just about any country by the ocean or major rivers. Cities may be in the Mountain Rangers or Forests but that is just a small percentage of cities. (Good example of this is Mexico City it was originally founded on top of a lake)

Writing Assignment Image that you are a lawyer working for the defense of Homer -Plessy write a persuasive speech (paragraph) to defend Plessy's actions in the Supreme Court in Plessy v Ferguson

Answers

Answer:

Being unfairly charged for boarding a white only train car, that law is unfair and unconstitutional. Sure it was a mistake but it is not worthy to be charged of.

Explanation:

PLEASE HELP ME ASAP!!!!

Answers

Answer:

The answer is Mexico

Explanation:

Amogus

I'm positive it's the correct answer

QUESTION 4: IMPACT OF UNEMPLOYMENT AND POSSIBLE SOLUTIONS
4.1 Summarise the impact of unemployment using the following headings:
a) Personal impact
b) Social impact
c) Financial impact

Answers

Answer:

b)social impact

Explanation:

impact comes with its own social possible solutions

B social impact is the answer here

an agreement between the Pope and a ruler
excommunicated

concordat

contract

anulment

Answers

The answer is concordat.

—Evidence—
•] A concordat is an agreement between the pope and the ruler of a country.

What type of climate typically has cool temps, cloudy skies, and is often rainy?

Answers

Answer:

temperate climate

Explanation:

temperate climate is the climate which has a cool temp and rainfall because sun s rays are slanting

what are various personality traits that are generally found in each individual?​

Answers

Answer:

well there are very many character traits like kindness jealousy sadness anger excitement. And many many more.  

Explanation:

Personality traits reflect people's characteristic patterns of thoughts, feelings, and behaviors. Please mark me the brainiest

What do Cuba and Brazil have in common?

Your answer:

The majority of tourists in both nations are from the United States.


The dominant language in both countries is Spanish.


Because of location, both countries have a tropical climate.

Answers

Answer:

c. because of location, both countries have a tropical climate

Explanation:

i'm not too sure about the tourist thing, but the dominant language in brazil is portuguese and the dominant language in cuba is spanish.

good luck :)

i hope this helps

have a nice day !!

What did Europeans hope to find by exploring Africa

Answers

Answer:well it’s simple just “you’re a Baka”
European will travel to Africa to buy slaves. 2. European would travel from Africa to the Americas and sell the slaves there.

How do countries invest in capital goods

Answers

Answer:

below

Explanation:

Capital investment occurs when businesses purchase capital goods, which are tangible assets such as buildings, machinery, equipment, vehicles, and tools. These tangible assets are then used to produce goods or services. Capital investment is a means for a company to further its business objectives.

Which of these presidential activities is not protected by the power of executive privilege?
A.)conversations with advisors about unlawful party activities
B.)discussions with advisors about ways to increase party power
C.)meetings with advisors about the actions of specific legislators
D.)strategic planning sessions with advisors about foreign diplomacy

Answers

The answer to this question that is not protected by the power of executive privilege is A.

Should the government pay for all peoples college ?

Answers

Answer:

no in my apinon

Explanation:

John Stuart Mill proposed the "harm principle," which basically is the idea that every individual should:​ a. ​be controlled by social institutions at all times to limit his/her ability to do harm. b. ​be imprisoned for life if they harm others or themselves. c. ​have the utmost freedom over their own actions unless they harm others. d. ​limit their behavior to that which is not harmful to any living thing.

Answers

Answer:

C. ​have the utmost freedom over their own actions unless they harm others.

Explanation:

The harm principle by stuart is the idea that people are free and have the right to act in whatever way them deem fit except what they do brings others to harm. Anything that can cause others harms is wrong and very wrong that the state can get involved to make sure that such does not occur again.

This idea is one tenet of liberalism, which is a philosophy in political science. This was proposed by John stuart Mill.

Which of these BEST shows how societies encourage the saving of energy resources?
A. by keeping gasoline prices low
B. by taxing investors in wind farms
C. by requiring cars to be fuel efficient
D. by limiting the amount of public transportation
sty

Answers

Answer:

that's a tough one I'm pretty sure it b

Other Questions
Eloise spent $1.65 on potato salad that costs $0.25 per pound. How many pounds of potato salad did she buy? - Identify which 2 positions the Earth is in during an equinox. For what reason are the ideas of democracy and the practice of democracy in separately linked? Mr. Rogers wanted to study the affect of different types of music would have on students ability to complete the IA. What is his dependent variable? What Is his independent variable ?A. classroomsB. types of musicC. IA scoresD. students Monopolies are inefficient compared to perfectly competitive firms because monopolies produce output with average total cost exceeding average revenue produce output with average total cost exceeding average revenue A produce more output than is social desirable produce more output than is social desirable B charge a price less than marginal revenue charge a price less than marginal revenue C charge a price greater than marginal cost charge a price greater than marginal cost D charge a price less than average total cost A baseball is hit in the air. Its height above the ground is described by the function Ht=-16t^2+45t+5, where H(t) represents the height in feet of the ball t seconds after it is hit. To the nearest hundredth of a second, for how much time will the ball be in the air? Find algebraically. help guys plz i suck at math, also step by step is needed Branliest is the reward like always Help, please help!!!!!!!!!!!!!!!!! the difference of two numbers is 7. Three times the greater number is 72. find the numbers What is an example of biotechnology? who is VluspPlease help ASAP!!!!! What is the strongest piece of evidence in the second paragraph of thearticle by Douglass?A)greatness in the ability to organizeB) greatness in the ability to discover truthTheodore Parker's three grades of human greatnessD) greatness in executive and administrative ability PLEASE HELP ME IM GIVING EVERTYTHING FOR THISAll About Me Graffiti Wall PowerPointWorth 25 PointsDue Thursday, April 1, 2021 i dunno TvTSAYS I NEED MORE WORDS OK HERE I AM what does martin luther king jr urge americans to do after police attack protestors on the bridge Please complete the following DNA strands1. AGGTCCAAGCTCAAATTTCCCC2. GAAACCCCTTAAACCTTAATTCC3. GCGCGCGCAAATTTTTCCCATCTPlease complete the following strands using RNA:1. AGGTCCCAAAGGCCCTTTCC2. UAAAGGGCCCAGCCCACC3. CUAAAAGGGGGUUUUAACC Can someone plzzzz help meeee!!!!! Wayne charges the following for repairing washing machines:28 call-out charge + 16 for each half-hour he spends on the repairIf a repair costs 76, how long did it take? 103+1793=????????what is the answer?? Answer both parts please Helpppp me pleaseee