Answer:
D
Explanation:
The only process in the model that takes carbon dioxide out of the atmosphere is process D.
Process D is otherwise known as photosynthesis and it is peculiar only to green plants and blue-green algae.
During this process, the atmospheric carbon dioxide combines with another inorganic substance (water) in the presence of sunlight energy to produce carbohydrates (glucose). Oxygen is released as the by-product of the process and the equation is as below:
[tex]6CO_2 + 6H_2O + sunlight --> C_6H_1_2O_6 + 6O_2[/tex]
Feeding problems may develop during the preschool years partially because of:_______
a. decreased appetite associated with decreased growth rate.
b. increased appetite associated with increased growth rate.
c. increased metabolic rate.
d. increased need for finger foods.
Answer:
The correct option is A.
decreased appetite associated with decreased growth rate
Explanation:
Feeding problems may develop in preschool age because of decreased appetite associated with decreased growth rate and this is because at the preschool age, there is no rapid growth, the growth rate is reduced which is as a result of decreased appetite for food. We all know that food supply the body with energy and necessary nutrients for growth. When there is decreased appetite enough food needed for growth will not be consumed , hence decrease growth rate.
HELP QUICK HELP ILL MARK U BRAINLIST
Answer:
B or A I think B
Which atom is involved in giving your heart energy to beat?
O carbon
O gold
O oxygen
O iron
Answer:
Oxygen
Explanation:
-How fast the heart beats depends on the body's need for oxygen-rich blood. At rest, the SA node causes your heart to beat about 50 to 100 times each minute. During activity or excitement, your body needs more oxygen-rich blood; the heart rate rises to well over 100 beats per minute.
-The heart, like any organ, requires blood for oxygen and other nutrients so it can do its work. The heart does not gather oxygen or nutrients from the blood flowing inside it. Instead, it receives blood from coronary arteries that eventually carry blood into the heart muscle.
17. Why did cover crops fall out of favor in the 20th century?
O A. Selective herbicides were developed to kill weeds.
O B. Cover crops worsen soil structure.
O C. Cover crops reduce water infiltration into the soil.
O D. Cover crops were no longer beneficial.
To find new and alternative farming methods and practices, private companies often fund their own research and development teams.
False
True
Answer:
FALSE ALL DAY LONG
Explanation:
Giving points and brainliest to the first person
Which is a characteristic of diatoms?
Diatoms have two distinct shapes: a few (centric diatoms) are radially symmetric, while most (pennate diatoms) are broadly bilaterally symmetric.
What are Diatoms?Any member of the vast group of several genera of microalgae that can be found in the world's oceans, streams, and soils is referred to as a diatom.
Diatoms can photosynthesize, which allows them to change the dissolved carbon dioxide in the water into oxygen.
For higher-ranking organisms in the food chain, like invertebrates and tiny fish, they serve as a major source of food. In the energy and nutrition cycles of water resources, diatoms can also be vital players.
Diatoms can be divided into two shapes: pennate diatoms, which make up the majority, are broadly bilaterally symmetric, and central diatoms, which make up the minority.
Thus, these are the characteristics of diatoms.
For more details regarding diatoms, visit:
https://brainly.com/question/11815815
#SPJ6
A stimulus is anything that causes a reaction or response. What is an example of an outside stimulus and an inside stimulus?
Answer:Stimulus: any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.
Explanation:
Answer:
hi
Explanation:
any change in an organism's environment that causes the organism to react. It is a fancy way of saying “cause”. Example: An animal is cold so it moves into the sun.
5. The lion researchers in the film have studied 20% of the park and identified 41 lions. (Show your
work/justify your answer for each section.)
a. The entire Gorongosa park is 4,000 km². Approximately how large (in km) is the portion of
the park that has been studied?
ASAP PLSS
Answer:
800 km²
Explanation:
If the researchers have studied 20% of the 4000 km² park, to find out how much of the park in km they have studied, all you have to do is find 20% of 4000.
4000 x .20 = 800
800 km² is your answer.
If the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].
What do you mean by the researcher?A researcher may be defined as a kind of person who significantly carries out academic or scientific research in order to find some unrevealed data and information.
According to the question,
The total area of Gorongosa park = Gorongosa park is 4,000 km²
The area which is already studied = 20%.
Now, you have to find the area that is already studied in km. So, you have to calculate the 20% of 4,000 km².
The area which is already studied = 4000 × .20 = 800 [tex]km^2[/tex].
Therefore, if the area of the entire Gorongosa park is 4,000 km². Among which, 20% of the park is already studied, it means 800 [tex]km^2[/tex].
To learn more about Researchers, refer to the link:
https://brainly.com/question/28136063
#SPJ2
1.How does Nitrogen cycle through the enviroment?
2. Trace the steps that carbon cycles from plants,animal,and enviorment?
Answer: 1. The nitrogen cycle is a biogeochemical cycle.
2. The carbon cycle is a biogeochemical cycle.
Explanation:
1. The nitrogen cycle can be defined as the biogeochemical cycle in which the atmospheric nitrogen is utilized by the plants which is fixed by the soil bacteria. The nitrogen becomes the part of the biosphere as plants utilize it as an important development mineral. The nitrogen cycle involves the nitrogen fixation in which plants fix nitrogen by the help of bacteria into ammonia, nitrification in which the ammonia is converted into nitrite, nitrogen assimilation in which the plants assimilate and utilize the nitrogen for their growth and development, and denitrification involves the reduction of nitrite into atmospheric nitrogen. The conversion of nitrogen is carried out via physical and biological processes.
2. The carbon cycle involves the atmospheric carbon dioxide being circulated in plants as they utilize it for photosynthesis. The carbon dioxide is fixed by the plants in the form of carbohydrate which is consumed by the animals and on decomposition of plants and animals dead matter release carbon dioxide gas to the atmosphere. This allows the recycling of the carbon dioxide gas in the environment.
FIND THE INDEPENDENT & DEPENDENT VARIABLE!
- the amount of iron in blood depends on the amount of red meat a person eats.
Answer:
The answer is:
Independent: red meat eaten by a person
Dependent: iron in the blood
Explanation:
A dependent variable has to depend on something else, so in order for a dependent variable to exist or happen, there has to be the independent variable. The independent variable is something that does not need anything else to happen for it to take place. It s independent. Such as, a mother cannot have a child without sperm. The mother have a child is dependent, where the sperm is independent.
The rate at which a stars burns its fuel (gas) is based on the star's
Mass
Volume
Shape
Color
Answer:
based on the mass of the star
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
please help with this question
Answer:
a -5
d -2
c-3
b-4
e - 5
Explanation:
I'm guessing this is the answer
3.4.3 Lab: Why are cells so small?
Answer: The important point is that the surface area to the volume ratio gets smaller as the cell gets larger. Thus, if the cell grows beyond a certain limit, not enough material will be able to cross the membrane fast enough to accommodate the increased cellular volume. ... That is why cells are so small.
Explanation: because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. ... When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume. Cells are small because they are more efficient as smaller entities. Information within small cells is transmitted more quickly and efficiently than within larger cells. ... Thus a higher cell surface area-to-volume ratio, i.e., smaller cell size, is desired for most efficient cellular activity.
The cells are so small because their small size allows them to take in food and get rid of the waste.
The cells are the basic structural and functional unit of all organisms on earth except the Viruses. The size of the cell is so little it allows the organism to maximize the ration of surface area to volume. Smaller cells are expected to have greater ratio which promotes more molecules as well as ions to move across the plasma membrane.The small size of the cell facilitate to get the nutrients inside the cell and waste outside the cell quickly. Hence, small size of cell facilitates to get food inside and get rid of waste.Learn more about cell:
https://brainly.com/question/3142913
The Drosophila genes for white eyes (w), cut wings (ct), and tan body (t) lie at map positions 2.00, 15.0, and 21.0, respectively. Of 1000 progeny, 7 are double crossovers. What is the degree of interference
Answer:
The coefficient of interference, I, is 0.1 (10% expressed as a percent)
Explanation:
Available data:
genes for white eyes (w), cut wings (ct), and tan body (t) lie at map positions 2.00, 15.0, and 21.0, respectivelyOf 1000 progeny, 7 are double crossovers.The coefficient of interference, I, is complementary with CC.
I = 1 - CC
To calculate the coefficient of coincidence, CC, we must use the next formula:
CC= observed double recombinant frequency/expected double recombinant frequency
Note:
observed double recombinant frequency=total number of observed double recombinant individuals/total number of individuals expected double recombinant frequency: recombination frequency in region I x recombination frequency in region II.By knowing the positions of genes, we can estimate the distances in MU between them per region.
The distance between w and ct genes is 15 - 2 = 13 MUThe distance between ct and t genes is 21 - 15 = 6 MUNow that we know the distances, we can estimate the recombination frequencies by dividing each distance by 100.
recombination frequency of w-ct region = 13MU / 100 = 0.13recombination frequency of ct-t region = 6MU / 100 = 0.06Now that we know the recombination frequencies in each region, we can calculate the expected double recombinant frequency, EDRF, like this:
EDRF = recombination frequency in region I x recombination frequency in region II.
EDRF = 0.13 x 0.06 = 0.0078
Now, by knowing the total number of individuals in the progeny (1000) and the number of double crossovers (7), we can calculate the observed double recombinant frequency, ODRF:
ODRF = number of double crossovers / total number of individuals
ODRF = 7/1000 = 0.007
Finally, with the values of EDRF and ODRF, we can calculate the coefficient of coincidence, CC.
CC = ODRF/EDRF
CC = 0.007 / 0.0078
CC = 0.9
And by knowing the CC we can also get the coefficient of interference, I.
I = 1 - CC
I = 1 - 0.9
I = 0.1 = 10% (expressed as a percent)
Help me now please!!!!!!!!
How can the arrangement of atoms help explain how the white phosphorus and red phosphorus can both be pure phosphorus substances?
Answer:Phosphorus is a chemical element with symbol P and atomic number 15. A multivalent nonmetal of the nitrogen group, phosphorus as a mineral is almost always present in its maximally oxidized state, as inorganic phosphate.
Explanation:
Chemical element phosphorus has the atomic number 15 and the letter P in its symbol. Phosphorus, a multivalent nonmetal belonging to the nitrogen group, is generally always found in the form of inorganic phosphate, which is phosphorus in its maximally oxidized state.
What is phosphorus?The mineral phosphorus, which is also available as a supplement, is naturally present in many foods. It serves the body in a multitude of capacities. It is a crucial component of cell membranes, bone, and teeth. It maintains a healthy range of blood pH and aids in the activation of enzymes.
All tissues and cells must have phosphorus for growth, maintenance, and repair as well as for the creation of DNA and RNA, the genetic building blocks. The balance and usage of other vitamins and minerals, including vitamin D, iodine, magnesium, and zinc, depend on phosphorus as well.
Thus, Chemical element phosphorus has the atomic number 15.
For more information about phosphorus, click here:
https://brainly.com/question/4622631
#SPJ2
Neurons are either classified by their structural differences or their ? differences.
**anatomy & physiology question**
if you are at a 60X magnification and the field diameter is 3.2mm an object that's about 1/4th the size of the field diameter what is the size of the object?
Answer:
0.8mm.
Explanation:
If the size of an object is about 1/4th the size of the field diameter so the size of an object is 0.8mm because the fourth part of field diameter is equals to 0.8mm. Due to knowing field diameter of microscope we can calculate the real size of objects that is too small which can't be seen with the naked eye. So one fourth part of field diameter is equal to 0.8mm.
Choose all the right answers. Which items are common features of most mammals? produce milk come in all sizes fertilized egg develops inside the body have fins eggs laid outside of body have scales some mammals live in water all have hair or fur
Answer: Some mammals live in water all have hair or fur.
Explanation:
In which experimental set up shown would you expect the Elodia plant inside a test tube to produce the least amount of oxygen
Answer:
Due to less concentration of carbondioxide gas.
Explanation:
Elodia plant inside a test tube produces the least amount of oxygen due to limited carbondioxide gas that is necessary for photosynthesis process. If a test tube has less amount of carbondioxide gas which is a reactant in photosynthesis so in the end the Elodia plant generates less amount of glucose as well as oxygen while on the other hand, if there is more carbondioxide gas is available to Elodia plant, more oxygen as well as glucose is produced.
how is cancer cell division different from regular cell division
What causes ocean tides to reach higher up on a shore at certain times of day than at others? A. The moon's gravity and Earth's rotation B. The ocean's conveyor belt and refraction C. Earthquakes and volcanoes O D. Temperature and salinity differences
Answer:
A
Explanation:
I read about ocean tides. the Moon has an effect on the ocean which causes the ocean to bulge toward the Moon. When the Moon is in alignment with the sun the ocean bulges out more because of the added gravity. The Moon though smaller than the sun has more gravitational pull than the sun.
PLEASE HELP IM GIVING 50 POINTS FOR THIS!!!!!!!! ALSO BRAINLIEST
Plan a controlled experiment that uses the simulation to investigate how changing the mass of an object changes its acceleration. The net force on the object must stay the same. Record your plan here.
It is possible to measure how acceleration changes with mass by throwing objects with different mass from the same height and measuring the acceleration.
What are the important factors for the experiment?This experiment requires you to measure how acceleration changes if the mass changes. This implies you need to consider the following factors:
Acceleration: This factor is the one you will measure in your experiment.
Mass: This factor is the one you will need to control, this implies using objects from different masses and comparing if mas has any effect on acceleration.
Other: Net force, wind, etc. are other factors that need to be constant to prevent them affect the results.
Steps for the experiment:
Choose a specific heigh: One of the ways of measuring acceleration is to throw objects and determine the acceleration as they fall, so the first step will be to establish a height.
Throw different objects with different masses: You can begin with light objects and move into heavier objects.
Measure acceleration: Every time you throw an object, measure acceleration using the formula A = change in velocity/ time.
Learn more about acceleration in:
brainly.com/question/12134554
#SPJ1
What are the two products made during the electron transport chain?
Answer:
Water and ATP
Explanation:
Answer:
H20 and ATP
Explanation:
Hope this helps :)
What is the relationship between Distance and average number of species?
Answer: The relationship between species and distance is that more distance or space has more species and less space has less species.
Explanation:
It can easily be understood by taking the example of the island in such a way that the larger islands contains more species than smaller islands.
There are a diversity of species seen in a bigger islands, more in number and more in variety.
It is very important for the studying the various species and its conservation, protection and other factors.
So, more is the distance , more will be the number of species.
George Washington Carver was particularly interested in the products of what foods?
O Peanuts, sweet potatoes, soy
Peanuts, tobacco, soy
Peanuts, potatoes, corn
Soy, potatoes, sweet potatoes
Answer:
A - peanuts, sweet potatoes, and soy
Explanation:
Answer:
I looked it up and got peanuts, pecans, sweet potatoes, and soybeans...
Explanation:
what tissue breaks down food for energy
Answer:
When the stomach digests food, the carbohydrate (sugars and starches) in the food breaks down into another type of sugar, called glucose. The stomach and small intestines absorb the glucose and then release it into the bloodstream.
3. What type of bond holds the backbone together?
A. Covalent
B. Hydrogen
C. lonic
Answer: The answer is B
Explanation: