Keith owed Art some money, and Art was tired of waiting for Keith to pay him back. Art saw Keith walking down the street and decided to approach him with his aggressive Rottweiler Rox. Art let Rox lunge at Keith, and then asked him, "Are you ready to pay me back the money that you owe me now?" What if Rox the Rottweiler actually bites Keith? Rox recently bit another neighbor and is known for her vicious ways. Art would be liable to Keith for _____. battery negligence assault strict liability

Answers

Answer 1

Answer:

assault

Explanation:

Answer 2

Answer:

imma say assault

Explanation:

plz tell me if im right.


Related Questions

How does Levi from aka help better understand the government

Answers

Answer:

By making it better for others

Explanation:

It’s Ryun he’s amazing ok bye

There has been a high rate of bicycle accidents in your community. The local police department has decided to host free bicycle safety seminars at a local community center. The officers who conduct the trainings are being paid for the time they conduct these seminars.

Is this example a public policy?

Answers

Answer:

yes they are helping with the incidences of the bicycles

Explanation:

Yes they are helping by serving the public

What is a warranty?
(A) It is a stipulation about the contract.
(B) It is a stipulation essential to the main purpose of the contract
(C) It is a stipulation collateral to the main purpose of the contract.
(D) It is a statement of commendation by the seller.

Answers

Answer:

C) because when you give a warranty its collateral if the product is lost, breaks, and ect that why you pay a little extra money

Plz answer questions 3-10 correctly, will give brainliest​

Answers

If farted in a police station is that destruction of property if my fart melted the chair

An attempt by the seller to limit responsibility to the consumer in case anything goes wrong.

A - Disclaimer
B - Warranty
C - Defect
D - Contract

Answers

Answer:

D) A contract.. that the obvious because when you do business with anyone you would want to have a contract on deck because people play games and also so if things go wrong you have proof in court.

Please answer this question with two sentences. Ill give brainliest to whoever answers correctly with 2 sentences!

Answers

This is protected under the first amendment. When a flag is privately owned, the owner should be able to burn it if the owner chooses, especially if this action is meant in the form of protest. Congress responded to the Johnson decision by passing a Flag Protection Act, only to see the Supreme Court reaffirm Johnson by the same 5–4 majority in United States v. Eichman, declaring that flag burning was constitutionally protected free speech.

Essay on civil and criminal laws on malaysia?

Answers

Answer:

are various definitions of the term “legal system”. A Legal System is the framework of rules and institutions within a nation regulating individual’s relations with one another and between them and the government.(Book) In this world, there are many types of legal systems, but the few major legal sytems of the world today are civil law, common law, customary law, religious law, socialist and mixed law systems.

Civil law is the dominant legal tradition today in most of Europe, all of Central and South America, parts of Asia and Africa, and even some discrete areas of the common-law world, like Louisiana and Quebec. The origin of civil law is from the Roman law. The civil law is a set out of comprehensive system of rules which are applied and interpreted by judges. Besides that, civil law is older, more widely distributed and in many ways more influential than the common law.

Common law is a system of law that is derived from judges’ decisions, rather than statutes or constitutions. It is based on tradition, past practices and legal precedents set by courts through interpretation of statues, legal legislation, and past rulings.It is english origin and is found in United States and other countries with strong english influences

Customary law is a traditional common rule or practice that has become an intrinsic part of the accepted and expected conduct in a community, profession, or trade and is treated as a legal requirement. Not many countries in the world today will operate under a legal system which could be wholly customary. However, customary law still plays a sometimes significant role, like in the matters of personal conduct, in many countries or political entities with mixed legal systems.

Islamic law is derived from the interpretation of the Koran. Its primary objective is social justice, but also includes property rights, economic decision making, and types of economic freedom. Islamic law is mostly found in Pakistan, Iran, and other Islamic states.

Socialist law is based on fundamental tenets of Marxist-socialist state and center on concept of economic, political, and social policies of the state. It can be found in some independent states of the former Soviet Union, China and other Marxist-socialist states.

A mixed legal system is a mixture of two or more legal system practised by some countries.

2.0 Malaysia’s Legal System

Different country practices different types of legal system. Some country practices one type of legal system while others practices the mixed legal system which means a combination of two or more legal systems. Malaysia for example, practices the mixed legal system which includes the Common Law, Islamic law and Customary Law. Malaysia’s legal system comprises laws which have arise from three significant periods in Malaysian history dating from the Malacca Sultanate, to the spread of Islam to Southeast Asia, and following the absorption into the indigenous culture of British colonial rule which introduced a constitutional government and the common law. Malaysia’s unique legal system is designed to balance the delicate racial and religious needs of its heterogeneous people. The Malaysian legal system law can be classified into two . However, according to the democratic ruling system, the Chief Executive is the Prime Minister. This does not mean that the Yang di-Pertuan Agong is unable to voice any opinion, but rather that he must act on government advice, whatever his personal view might be. The Yang di-Pertuan Agong appoints a Cabinet to advise him on country’s matter. The Cabinet consists of the Prime Minister and a number of Ministers who must all be members of Parliament. Besides that, the Government has set up various agencies to ensure the smooth enforcement of the law. It comprised of three main components, namely ministries, departments and statutory bodies.

laws pertaining to persons professing the religion of Islam.

Share this:

Cite This Work

To export a reference to this article please select a referencing stye below:

OSCOLA

APA

MLA

MLA-7

Harvard

Vancouver

Wikipedia

All ltd, 'L

Trustedsite Law

Brown v. Board, Main points, argument, and violations. I am expecting a decent paragraph! (10 Sentence!) Majority Opinion for the brief also!

Answers

Answer:

The Supreme Court's opinion in the Brown v. Board of Education case of 1954 legally ended decades of racial segregation in America's public schools. Originally named after Oliver Brown, the first of many plaintiffs listed in the lower court case of Brown v. Board of Education of Topeka, KS, the landmark decision actually resolved six separate segregation cases from four states, consolidated under the name Brown v. Board of Education. While the attorneys originally argued the cases on appeal to the Court in 1952, the featured document, School Segregation Cases - Order of Argument, offers a window into the three days in December of 1953 during which the attorneys reargued the cases.

A reargument was necessary because the Court desired briefs from both sides that would answer five questions, all having to do with the attorneys' opinions on whether or not Congress had segregation in public schools in mind when the 14th amendment was ratified. The document lists the names of each case, the states from which they came, the order in which the Court heard them, the names of the attorneys for the appellants and appellees, the total time allotted for arguments, and the dates over which the arguments took place.

The first case listed, Briggs v. Elliott, originated in Clarendon County, South Carolina, in the fall of 1950. Harry Briggs was one of twenty plaintiffs who were charging that R.W. Elliott, as president of the Clarendon County School Board, violated their right to equal protection under the fourteenth amendment by upholding the county's segregated education law. Briggs featured social science testimony on behalf of the plaintiffs from some of the nation's leading child psychologists, such as Dr. Kenneth Clark, whose famous doll study concluded that segregation negatively affected the self-esteem and psyche of African-American children. Such testimony was groundbreaking because on only one other occasion in U.S. history had a plaintiff attempted to present such evidence before the Court.

Explanation:

WHAT CRIMES ARE COMMITTED BY BOTH MEN AND WOMEN (give 5 crimes)

Answers

, murder, robbery, assault, kidnapping.

Answer:

1. Embezzlement

2. Domestic Violence

3. Murder

4. Car Theft

5. Extortion

Explanation:

In Hamdan v. Rumsfeld , the U.S. Supreme Court held that detainees in Guantanamo:____.
a. ​deserved some due process and that the military commissions created at the time were not sufficient.
b. ​did not deserve some due process and that the military commissions created at the time were sufficient.
c. ​did not deserve some due process and the military commissions created at the time were not sufficient.
d. ​deserved some due process and that the military commissions created at the time were sufficient.

Answers

Answer:

c

Explanation:

What is element identification in the legal practice?

Answers

Answer:

this is what I found online:

"Element Identification is a helpful skill to decide what action is needed…… (IE levels of research via sources and or investigation.) By taking each legal situation and breaking. From this point you may begin identifying the. legal issue of the complaint/case."

____ and ____ are the two forms of contracts.

Answers

Answer:

fixed price contracts and cost-reimbursement contracts

19. To bring a derivative suit, a shareholder must own stock at the time of the
A. injury and at the time of the suit.
B. injury only
C. suit only
D. trial, suit, and injury

Answers

Answer:

A. injury and at the time of the suit.

Explanation:

A corporation can be defined as a corporate organization that has facilities and owns or controls assets used for the production of goods and services in at least one country other than its headquarter (home office) located in its home country.

This ultimately implies that, a corporation is a corporate organization that owns or controls its business in two or more countries.

One of the advantage of a corporation is that, owners have limited liability for debt to the extent to which they have invested and as such are not personally liable for some of the debt owed by corporation.

A derivative suit can be defined as a lawsuit that's brought forward by a shareholder on behalf of a corporation, to either defend or enforce a legal right (claim) against a third party such as a director or executive officer in the corporation.

Hence, to bring a derivative suit to a court of competent jurisdiction, a shareholder must own stock at the time of the injury and at the time of the suit.

juvenile means what?

Answers

Answer: A "juvenile" is a person who has not attained his eighteenth birthday, and "juvenile delinquency" is the violation of a law of the United States committed by a person prior to his eighteenth birthday which would have been a crime if committed by an adult.

please give brainlest if this helps!

In criminal justice systems a youth detention center, known as a juvenile detention center (JDC), juvenile detention, juvenile hall, or more colloquially as juvie/juvy, also sometimes referred as observation home or remand home is a prison for people under the age of 21, often termed juvenile delinquents, to which they ...

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

Answers

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

What is the default join type?

Answers

Ans: SQL inner join


The simplest and most common form of a join is the SQL inner join the default of the SQL join types used in most database management systems. It's the default SQL join you get when you use the join keyword by itself. The result of the SQL inner join includes rows from both the tables where the join conditions are met.

Answer:

If this is for edge....it’s A) inner

Explanation:

The petitioner is the party against whom a petition is filed, especially one on appeal.

A.) True
B.) False

Answers

Answer: I believe its false

Explanation:

The course of action a government takes in response to an issue or problem is called
federalism.
A. Federalism
B. Bureaucracy
C. public policy.
d. interstate policy.

Answers

A. Federalism

:)
I am typing extra words because it won’t let me answer until I have 20 characters.
Federalism is the correct answer

Candidates for the U.S. House of Representatives must be at least 25 years old, and candidates for the U.S. Senate must be at least how old? Select one: O A. 25 O B. 21 Ос. 30 O D.35​

Answers

Answer:

It is C.30 years old

Explanation:

Answer: to be senator you must be over the age of 30 years old. To be represenative a person must be 25 of age or older.
Explanation:This is specified in the U.S. Constitution. Most states in the U.S. also have age requirements for the offices of Governor, State Senator, and State Representative.


Please give me brainlyyy❤️❤️

Damian and Hunter are college roommates from very different walks of life. Damian was raised in a poverty-stricken city by a single mom. Hunter is the son of a small-town doctor and his socialite wife. Regardless, they get along well. Over time, they become known around campus as a good source for illegal drugs. For several years, Damian and Hunter run their business successfully. When the police finally catch up with them, they are both arrested. Following the theory of radical criminology, what is MOST likely going to happen to the two men?

A.
Damian will get an easier sentence because he did not have the advantages that Hunter did.

B.
Hunter will get a harder sentence because he had more privileges growing up.

C.
Both men will get equal sentences under the law.

D.
Damian will get a harder sentence because of his background.

Answers

Answer: D. Damian will get a harder sentence because of his background

Explanation:

Radical criminology bases its opinion on the fact that the state uses its power to make laws that will be beneficial to the ruling class while the working class are left out. It simply means that the laws made benefits the rich at the expense of the poor in the society.

Therefore, since Damian was raised in a poverty-stricken city by a single mom while Hunter is the son of a small-town doctor and his socialite wife, Damian will get a harder sentence because of his background.

Which of the following is a belief held by the theory of natural law?

Answers

According to natural law theory, all people have inherent rights, conferred not by act of legislation but by "God, nature, or reason." Natural law theory can also refer to "theories of ethics, theories of politics, theories of civil law, and theories of religious morality." Natural law has roots in Western philosophy.

Natural law - Wikipediahttps://en.wikipedia.org › wiki › Natural_law

What can people do if they feel that a law is unfair?

Answers

People who think that the law is not fair can approach the court to decide on the issue. The court has the power to modify or cancel laws if it finds that they don't adhere to the Constitution.
hope this help!

Answer: People who think that the law is not fair can approach the court to decide on the issue. The court has the power to modify or cancel laws if it finds that they don't adhere to the Constitution.

B. How many members are in the House of Representatives? Why?

Answers

Answer:

There are 535 members.

Explanation:

Five delegates and one resident commissioner serve as non-voting members of the House, although they can vote in committee.

Answer:

435

Explanation:

commissioner serve as non-voting members of the House

How is the citizen important in American heroes

Answers

Answer: they ply there important roles as citizens

Explanation:

Can you sue and win if someone is black mailing you over something illegal you did. If not is there any thing else you can do to take legal action and protect yourself.

Answers

I’m not sure that you’d win the argument as you could possibly face repercussions of the act you did that was illegal...two wrongs won’t make a right basically.

Which of the following actions is illegal for selling alcohol

Answers

Answer:

no options

Explanation:

I’m not sure what the options are but reselling alcohols in some states in the United States is in fact illegal.

Bistro Caterers contracts with Corporate Towers to cater the firm’s business meetings. Later, the contract between Bistro and Corporate is completely rescinded. Even later, Bistro offers to make a new deal. Corporate is willing to deal, but for a new price. Bistro and Corporate
a. may agree to a new contract, but it cannot include a new price.
b. must perform the part of their original contract that is executory.
c. must perform their original contract.
d. may agree to a new contract that includes the new price.

Answers

Answer:

d. may agree to a new contract that includes the new price.

Explanation:

A contract can be defined as an agreement between two or more parties (group of people) which gives rise to a mutual legal obligation or enforceable by law.

There are different types of contract in business and these includes: fixed-price contract, cost-plus contract, bilateral contract, implies contract, unilateral contract, adhesion contract, unconscionable contract, option contract, express contract, etc.

Mutual assent is a legal term which represents an agreement by both parties to a contract. When two parties to a contract both have an understanding of the parameters, terms and conditions surrounding a contract, it ultimately implies that they are in agreement; this is generally referred to as mutual assent.

Since the original contract has been completely rescinded (declared void, repealed or annulled), Bistro and Corporate may agree to a new contract that includes the new price based on mutual assent between the two parties.

what is the example of red lie?​

Answers

red lie are lies to harm others

Explanation:

example:

Danice: Mr William Jake took your phone and smashed it on the ground

Mr William: What?

* Then Mr William argued with Jake and scolded him so therefore Danice told a red lie*

Hope it helps

A claim made with full knowledge that the opposing person already knows it to be untrue.

What is a red lie?

Red lies are just about retaliation and spite. The desire to hurt others, regardless at the cost of one's own harm, drives them. "A brilliant red lie" refers to a complete fabrication or something wholly at variance with the truth. The phrase "a red stranger" is another way we describe an individual who is a complete stranger.

An example of a red lie will is:

Even though you detest the meatloaf, you proclaim to your mother that it is excellent. You do not wish to tell her buddy that she's gained a significant amount of weight and appears heavy, so you respond as she asks saying he doesn't look big in her dress. In this, there is a  red lie that is presented.

Learn more about red lie, here:

https://brainly.com/question/25427223

#SPJ2

A(n) ___ is a type of microscope that can analyze the characteristic glow of different fibers.

Answers

Is it a fluorescence microscope ?

examination of bill of entry is done to vouch​

Answers

Answer:

What? I Don't understand

Explanation:

Answer: Custom !!!!!
Other Questions
4. A Tesla dealership is having a sale on their cars. This week you can save 15% offthe total price. If the retail price of the Tesla is $30,190, what is the discount? I'm begging you please please help please please ASAP please please help please please ASAP please please help please please ASAP please please help please please ASAP The taxpayer is a Ph.D. student in accounting at City University. The student is paid $1,500 per month for teaching two classes. The total amount received for the year is $13,500. a.The $13,500 is considered a scholarship and, therefore, is excluded. b.The $13,500 is excluded because the total amount received for the year is less than her standard deduction and personal exemption. c.The $13,500 is taxable compensation. d.The $13,500 is excludible if the money is used to pay for tuition and books. how did the heian period process of carving statues change during this period? Name 3 stages of cell division, and give a brief description of what happens in each stage? please help I really need some help with this much appreciated A roller skating rink charges a skate rental fee and an hourly rate to skate.The total cost to skate for 2 hours is $9.50 and for 5 hours is $18.50.Assume the relationship is linear. Find and interpret the rate of change andwhere x represents the number of hours and y represents the total cost.initial value. Then write the equation of the function in the form y = mx + b In what way is the plot an important element of a short story HELP ME! is iodine solution polar, non-polar, or ionic?Please don't attach links, i will report you What does it mean to go above and beyond? To travel to far away places To do a little bit of extra work To explore outer space To do only what is necessary The cost of renting a bicycle, y, forx hours can be modeled by a linearfunction. Renters pay a fixed insurancefee of $12 plus an additional cost of $10 per hour, for a maximum of 6 hours.What is the range of the function for thissituation?F {22, 32, 42, 52, 62, 72}G {1, 2, 3, 4, 5, 6}H {12, 24, 36, 48, 60, 72}J {22, 34, 46, 58, 70, 82} Find the area of the following figure: 14ft 6ft 9ft Expand and simplify these 6 questionsfirst one: 2(1x + 3) - 5second one: 3(1x + 7) + 3xthird one: 4(1x + 2) + 8fourth one: 4(1x + 1) - 6fifth one: 2(3x + 2) - 5xsixth one: 5(1x - 4) + 10 The stock of Company A gained 6% today to $94.87. What was the opening price of the stock in the beginning of the day? The expenses E and income I for making and selling T-shirts with aschool logo are given by the equations E = 535 +4.50n and I = 12n,where n is the number of T-shirts.Expenses: Slope=Y-Intercept =income: Slope=Y-Intercept Write 0.4% in simplest form A jar contains 10 red marbles, 30 blue marbles, 10 green marbles, and 35 orange marbles. Find the probablilty of picking a marble. Need to get this one right to pass lesson What powers do the federal government and the states have in the ratification of an amendment?I need helppplplplplplplpllpl fast The mathematical sentence that describes the inequality 5n - 10 > 26 is: Ten subtracted from 5 times n is greater than 26. I hope this mathematical sentence is what you are looking for,Write the inequality in words.5n 10 > 26A. Ten less than a number is less than or equal to twenty-six.B. Ten less than five times a number is greater than twenty-six.C. Five times n less than ten is twenty-six.D. Ten plus five times n is less than or equal to twenty-six.Answer:Write the inequality in words.5n 10 > 26Step-by-step explanation:Isolate the variable by dividing each side by factors that don't contain the variable.Inequality Form:n > 36/5Interval Notation:(36/5, )THANKS 0 The volume of a cylinder is 256pi in 3 and the height of the cylinder is 1 in what is the radius of the cylinder