Joyce and Linda are identical twins who are 50 years old and enjoy exercising daily. Joyce avoids eating any dairy or animal products and eats granola made with canola oil for breakfast. Linda prefers rich foods, and eats bacon, eggs, and buttered toast each morning. Which statement describes a logical inference that can be made from the provided information?
Butter has higher levels of saturated fats in it than canola oil.
Linda and Joyce both have high levels of “bad” cholesterol.
Butter contains a small amount of polyunsaturated fats.
Linda has a higher level of “bad” cholesterol than Joyce.

Answers

Answer 1

Answer:

Linda has a higher level of “bad” cholesterol than Joyce.

Explanation:

Answer 2

Answer:

B

Explanation:


Related Questions

NO LINKS PLEASE

Why are there always more producers than consumers in an ecosystem?

O A. Plants do not carry out enough photosynthesis to supply the needed oxygen to primary consumers.

O B. The Sun cannot supply enough energy to support many predators.

O C. Energy is lost in food chains so many secondary consumers cannot be supported.

OD. Many consumers would contribute too much carbon dioxide to the carbon cycle.

Answers

Answer:

energy is lost in the food chains so many secondary consumers cannot be supported

11. When cold temperatures are produced in a chemical reaction, the reaction is
known as
a. exothermic.
b. endothermic.
c. suspension

Answers

Answer:

it's known as endothermic reaction

Small changes can add up over MULTIPLE GENERATIONS to make
A. the same species

B. new species

Answers

Answer:

b: new species

Explanation:

These changes are genetic mutations to their biological "code" meaning creating a new species would be possible.

Answer:

B. new species

Explanation:

Biological evolution is any change in the heritable traits within a population across generations.

if the mass extinction event that had wiped out the dinosaurs had not occurred, could dinosaurs rather than mammals have evolved into an intelligent organism resembling modern day humans ?

Answers

Answer:

If the mass extinction even that had wiped out the dinosaurs had not occurred, dinosaurs would've evolved. Though maybe not into organisms that resemble modern-day humans, they would've become better versions of themself. However, some of them might've died out naturally due to climate change and other natural disasters.

If the mass extinction event had wiped out the dinosaurs and not occurred. The dinosaurs would not have been converted into an intelligent organism like humans, because evolution may be bad or good, nothing is always evolution that results in good traits.

What are dinosaurs?

Dinosaurs are extinct reptiles, that were very big, and they were both herbivorous and carnivorous. These animals were present 56 million years ago. They got extinct because of an unknown reason, but scientists say that they got extinct due to the falling of meteorites.

If dinosaurs had not been extinct, they would be evolved according to the changes in the environment. They would not be converted into human intelligence.

Therefore, since evolution can be either positive or negative, there is no guarantee that it will always produce positive features in organisms, the dinosaurs would not have evolved into sophisticated beings like humans.

To learn more about dinosaurs, refer to the link:

https://brainly.com/question/15973044

#SPJ5

Why do many water animals not have a well developed blood system?​

Answers

The simplest animals, such as the sponges (Porifera) and rotifers (Rotifera), do not need a circulatory system because diffusion allows adequate exchange of water, nutrients, and waste, as well as dissolved gases. Instead, gases, nutrients, and wastes are exchanged by diffusion.

Answer:

Explanation:

The simplest animals, such as the sponges (Porifera) and rotifers (Rotifera), do not need a circulatory system because diffusion allows adequate exchange of water, nutrients, and waste, as well as dissolved gases. ... Instead, gases, nutrients, and wastes are exchanged by diffusion.

(a) Describe why DNA replication is said to be a semiconservative process. Explain how random mutations such as those in pathogens with a mutator phenotype may arise in the DNA of an organism.

Answers

Explanation:

yan po sana makatulong po

sainyo

Blood type A person marries a blood type B person, both are heterozygous for the trait, what could their offspring be?
AB
B
A
O
all of the above

Answers

Answer:

All of the above

Explanation:

We don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.
A. True

B. False

Answers

A. True

variation of reproduction produces diverse life forms and allows organisms to evolve complex characteristics over billions of years.

Answer:

A. True

Explanation:

Yeah, we don't know what the first life form was or how it came to be, but the process of reproduction with VARIATION over billions of years is responsible for the diversity of life on Earth today.

help pls *serious ppl only*

Answers

There is 1 white parent and 1 black parent

Explain the difference in How the tree and the fox get carbohydrates to use for energy

Answers

Hey Hey!

Hmm... This seems to be a simple questions. Plants/trees actually make their own carbohydrates through photosynthesis. A fox simply eats food and that is their carbohydrate source. Please mark brianliest<3!

Which of the following shows the stage of mitosis in the correct order?​

Answers

answer: B !

hope this helps! please mark me as brainliest :)

Prophase, prometaphase, metaphase, anaphase, telophase, cytokinesis is the correct order of mitosis. Therefore, option (B) is correct.

Mitosis is a cellular process that ensures the accurate division of a cell's genetic material into two identical daughter cells. It consists of several distinct phases that occur in a specific order.

Interphase: The cell prepares for division by growing, duplicating its DNA, and synthesizing necessary proteins.

Prophase: Chromatin condenses into visible chromosomes, the nuclear membrane disintegrates, and spindle fibers form.

Metaphase: Chromosomes align at the center of the cell, known as the metaphase plate, and attach to spindle fibers at their centromeres.

Anaphase: Sister chromatids separate and are pulled to opposite ends of the cell by the spindle fibers.

Telophase: Chromosomes reach the opposite poles of the cell, and new nuclear membranes form around them. The chromosomes begin to decondense.

Cytokinesis: The cytoplasm divides, leading to the formation of two distinct daughter cells, each containing a complete set of chromosomes.

Learn more about mitosis, here:

https://brainly.com/question/31626745

#SPJ2

what is the mosquito average life's span​

Answers

It’s usually 7-8 days

The
store(s) more carbon than the atmosphere.
trees
soil
Oceans
rock

Answers

The oceans store more carbon than the atmosphere. Thus, the correct option is C.

What is Atmosphere?

An atmosphere may be defined as an area that is surrounded by layers of gases across a planet or other celestial body.

The oceans are a gigantic carbon sink, and the domain of the positive authorization of the greenhouse gas cycle is that, as the oceans become warmer, they tend to discharge more carbon dioxide disbanded in the water.

Therefore, the correct option for this question is C.

To learn more about Oceans, refer to the link:

https://brainly.com/question/25154137

#SPJ1

The arrows in a food chain show: a Who eats who b Heat energy being lost c The movement of energy between organisms d The route of food to the shops

Answers

Answer:

c The movement of energy between organisms

Explanation:

Pyramid of energy is a model used to depict the flow of energy from one trophic level or feeding level to the next in an ecosystem. It's a diagram that compares the energy used by organisms at each trophic level of the food chain. The pyramid of energy must never be inverted or turned upside down.

The units used in the construction of pyramids of energy is kilocalories (kcal) or energy per area per time (Jm-²year-¹).

This ultimately implies that, the arrows in a food chain show the movement of energy between organisms such as from producers which are autotrophs or self-feeders such as plants to the tertiary consumers.

Furthermore, a list of the types of organisms in an eco pyramid are;

I. Producers: these are autotrophs or self-feeders such as plants.

II. Primary consumers: these are herbivores that typically feed on plants such as a goat or deer.

III. Secondary consumers: these consists of carnivores that typically feed or eat flesh such as lion, tiger, cheetah, etc.

IV. Tertiary consumers: these are higher predators such as humans that aren't normally fed on by other organisms in the ecosystem.

Answer: The arrows in a food chain show (The movement of energy between organisms). The correct option is C.

Explanation:

In an ecosystem, a food chain shows the transfer of energy and nutrients ( food) from organisms to organisms in a feeding pathway. Instead of giving functional group names such as primary producer, primary consumer and so on, in a good chain, the organism at each step is identified. Thus,

Grass-------> Zebra ---------> lion

(Primary (Primary ( secondary

producer). consumer) consumer)

this is an example of a simple food chain in a grassland ecosystem. This ARROWS represented above shows the direction of energy flow through an ecosystem.

Furthermore, the grass traps solar energy and stores it as chemical energy in the food made during photosynthesis. When eaten by Zebra, which is the primary consumer, the energy stored in the grass is transferred to the consumer. This transfer is inefficient as some of the stored chemical energy is lost as heat. When the zebra is eaten by a Lion,which is the secondary consumer.

Which molecule do mammals use to store extra glucose?
O starch
O cellulose
O myosin
O glycogen

Answers

The answer is glycogen
Because glycogen is an large storage molecule of extra glucose
The answer is D. Glycogen

plant store _____ and other essential nutrients in the vacuole

Answers

Answer:

Plant store water and other essential nutrients in the vacuole.

Explanation:

Plant store water and other essential nutrients in the vacuole.

What is herbal medicine?

Herbal medicine is defined as the medicine which is acquired from the various parts of the plants such as flowers, roots, shoots, and leaves. Herbal medicine are costly in compare to normal medicine and because there production is limited and there will be no side effect of herbal medicine in compare to allopathic medicine.

The main difference between herbal medicine and allopathic medicine is that the allopathic medicine is formed from the active or particular part of the plant but in herbal medicine whole plant parts are utilised.Herbal medicine are costly in compare to normal medicine and because there production is limited and there will be no side effect of herbal medicine in compare to allopathic medicine.

Therefore,Plant store water and other essential nutrients in the vacuole.

Learn more about plant here:

https://brainly.com/question/22167412

#SPJ2

How does the skin regulate body temperature?

Group of answer choices

by increasing sweat production

by producing vitamin D

by retaining water

by regulating fat content in the epidermis

Answers

Increasing sweat production

How does the skin regulate body temperature?

[tex]\circ \: \: { \underline{ \boxed{ \sf{ \color{green}{Answer.}}}}}∘[/tex]

A. by increasing sweat production. ✔

Explanation:-

The sweat glands present in the skin helps to cool the skin as it produces sweat.Sweat glands keeps the body temperature at approximately 37° C by releasing sweat in a hot environment or during physical exertion.

[tex]\bold{ \green{ \star{ \orange{Mystique35}}}}⋆[/tex]

what happens to the energy that is not converted to usable energy in a muscle Cell?

Answers

Answer:

The process is called oxidative phosphorylation and it happens inside mitochondria. In the matrix of mitochondria the reactions known as the citric acid or Krebs cycle produce a chemical called NADH. NADH is then used by enzymes embedded in the mitochondrial inner membrane to generate adenosine triphosphate (ATP).

Explanation:

which of these animals did NOT benefit from the reintroduction of wolves into Yellowstone?
a. rabbits
2. bears
3. elk
4. beavers

Answers

The answer is the elk

2. The movement of tectonic plates and the cycling of Earth materials are
the direct result of which of the following *

Nuclear fisson
Solar radiation
Thermal convection
Magnetic attraction

Answers

Answer :

Thermal convection

Explanation :

The heat from radioactive processes within the planet's interior causes the plates to move, sometimes toward and sometimes away from each other.

Answer:

Thermal Convection

Explanation:

Just trust me, it was on my quiz for stemscopes.

the tRNA for GUCAUCGAUCGAUCGGAUGCC

Answers

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

3) In order for an ecosystem to thrive, it needs to exist in a form of harmony and balance between its biotic and abiotic factors. Describe how small changes to both biotic and abiotic components can have major effects on an ecosystem.

Answers

Answer:

Changing temperature causes extinction or removal of organism from that place.

Explanation:

Small changes to both biotic and abiotic components can have major effects on an ecosystem because these are the factors on which the ecosystem depends. For example, if the temperature of the ecosystem increases from its limit, it makes the environment unfavourable for the organism so due to this change, the organism migrated to other location otherwise they will die due to unfavourable environment.

Does anyone know this?

Answers

The answer is C. Zygote blastocyst embryo fetus

Answer: The correct answer is zygote...blastocyst...embryo...fetus.

Explanation:

The zygote is the single cell that was the result of fertilization.

The blastocyst is the big ball of cells that was the result of differentiation and mitosis.

Then comes the embryo, and then finally, the fetus.

Good Luck <3

How long does it take the moon to rotate on its axis?


about 25.3 days


about 27.3 days


about 30 days


about 2 months

Answers

Answer:

27.3 days

Explanation:

The Moon takes 27.3 days to rotate on its axis as the Moon takes 29.5 days to revolve around the Earth. So, the correct option is B.

What is Rotation?

Rotation is defined as the circular movement of an object around a central axis where a two-dimensional rotating object has only one possible central axis and can rotate in a clockwise or counterclockwise direction, while a three-dimensional object has an infinite number of possible centers that is axes and rotational directions.

The Moon orbits the Earth in the same direction, completing one orbit relative to the vernal equinox and the stars in about 27.32 days while one orbit relative to the Sun takes about 29.53 days.

Thus, the Moon takes 27.3 days to rotate on its axis. So, the correct option is B.

Learn more about Rotation, here:

https://brainly.com/question/15672596

#SPJ6

The Montreal Protocol of 1987 provided a global framework to phase out chlorofluorocarbon (CFC) production and use. A though the Montreal Protocol has led to a dramatic decrease in CFCs released into the atmosphere, stratospheric ozone destruction has decreased only slightly.

Answers

Answer:

True

Explanation:

A student lifted weights after
from school and felt his muscles
they began to burn. He couldn't continue
lifting weights after doing
exercise for a long time. Is
muscle fatigue is most likely
due to:
(1) the acceleration of the heartbeat and
exhaustion of the heart
(2) the accumulation of oxygen in the
lungs
(3) the lack of oxygen and the accumulation of
waste in muscles
(4) the lack of carbon dioxide in the
muscles

(1) the acceleration of the heartbeat and
exhaustion of the heart
(2) the accumulation of oxygen in the
lungs
(3) the lack of oxygen and the accumulation of
waste in muscles
(4) the lack of carbon dioxide in the
muscles

Answers

Answer:

lack of oxygen and accumulation of waste in the muscle

Anyone know the answer?

Answers

3.gender:male

disorder name:non-disjunction(when the chromosomes fail to seperate or having extra number of chromosomes)

4.gender:female

disorder:down syndrome

What is the microscopic nature of a cell ?

Why nucleus is said to be the controller of cellular activities ?

How is a cell adapted to its small size?​

Answers

Answer:

No 1 answer They require sophiscated tools. The microscopes help in the study of cells. The molecular study of the cells are performed by the help of electron microscope. So, we can say that cells are microscopic in nature.

Explanation:

No 2 answer The nucleus is the largest and most prominent of a cell's organelles (Figure 3.7). The nucleus is generally considered the control center of the cell because it stores all of the genetic instructions for manufacturing proteins.

No 3 answer Smaller single-celled organisms have a high surface area to volume ratio, which allows them to rely on oxygen and material diffusing into the cell (and wastes diffusing out) in order to survive. The higher the surface area to volume ratio they have, the more effective this process can be.

Why do animals that are active at night tend to have trouble seeing in color?

Answers

Nocturnal animals have more rod cells in their eyes as compared to humans and other animals active during the day. These rod cells serve as light receptors and help them see in dim light.

HELP ME PLEASEEEE:(((

Answers

Answer:

C. Red

Explanation:

Red colour on the map shows the Mid Atlantic Ridge. The Mid-Atlantic Ridge  is also called as a mid-ocean ridge. It is an underwater mountain system formed due to plate tectonics. It is created due to a divergent plate boundary that started from 87° N about 333 km to the south of the North Pole which is 54 °S, which is north of the coast of Antarctica. In the picture, the red colour is the line that shows Mid Atlantic Ridge.

Other Questions
please show your work A total of 765 tickets were sold for the school play. They were either adults or students tickets. There were 65 more student tickets sold than adult tickets. How many adult tickets were sold? According to Ann Cooper, what specific diseases and health issues are directly caused by poor nutrition and food choices? Do you personally know anyone or have experience with any of the diseases discussed in the video? Because coupled transcription/translation requires that the two processes occur in the same subcellular space, it is likely that this coupling is found _____. Multiple choice question. only in the Eukarya domain in both the Bacteria and Archaea domains only in the Bacteria domain in both the Archaea and Eukarya domains only in the Archaea domain Check 2. The circumference of a circle is C centimeters. The diameter of the circle is 6 centimeters. Write an expression that represents the value of n. How much total money will Kiara have to pay back at the end of the 9 years? Three boys and four girls enter a contest at the local movie theater. A randomly chosen winner will be awarded a free movie ticket, a collectible poster, or free popcorn. What is the probability that a girl will win free popcorn?A. 3/21B. 4/21C. 3/7D. 4/7 Sound travels through the air in How does the Ivanpah Solar Plant make electricity? Which of the following are examples of natural pollution? Choose all that apply.car exhaustvolcanoespesticidestrashforest firesfloods Glucose is reabsorbed back into the blood by active transport define active transport A rock is thrown from the top of a building 146 m high, with a speed of 14 m/s at an angle 43 degrees above the horizontal. When it hits the ground, what is the magnitude of its velocity (i.e. its speed). Write a research-based argumentative essay for or against health care for everyone.75 points, brainiest to whoever gives a full essay, HURRY Consumer protection is NOT a modern idea, McKay states. Which ancient legal document talked about this concept? How much heat must be transferred to 3500 g of liquid water to change thewater's temperature from 27C to 32C? (The specific heat capacity of liquidwater is 4.186 J/g.C.)O A. 170 JO B. 73,000 JO C. 470,000O D. 2900 J Ethylene produced by fermentation has a specific gravity of 0.787 at 25 degree Celsius. What is the volume of 125g of ethanol at this temperature? (The density of water at 25 degree Celsius is 0.997 g/mL) what is the National Bank veto Value-Mart had 2,371 customers last week. Each customer donated $2 to the food bank. How much money did Value-Mart raise for the food bank? * Jun 07, 9:22:26 AM+Write a sine function that has anamplitude of 2, a midline of 3 and a period of 3/2. Which clastic sedimentary rock is made of the smallest grains?1) Conglomerate2) sandstone3) siltstone4) shale