Jimmy is in New York City to see a Drake concert. He needs to get
from his Airbnb to the concert venue, so he decides to take a cab.
The cab charges a $3 boarding fee in addition to charging $0.50
per mile traveled. Jimmy gave the driver a $2 tip and paid $10.
How far away was the concert venue?

Answers

Answer 1

Answer:

16

Step-by-step explanation:

y= .5x+3

10=.5x+2


Related Questions

helphelphelphelphelphelphelphelphelphelphelphelphelphelphelphelphelphelphelphelphelp

Answers

Answer:

A proportional relation is a logical relation that establishes a range of conditional relations that together involve direct or inverse correlation.

Some common unit rates are miles (or kilometers) per hour, cost per item, earnings per week, etc. In each case the first quantity is related to 1 unit of the second quantity.

A unit rate describes how many units of the first type of quantity corresponds to one unit of the second type of quantity.

I have to make sure that there is at least one variable that directly effects another.

Some equations are y = 3x, y = 1.5x, and y = 2/3x.

Step-by-step explanation:

Find the measures of the vertical angles shown. Show all work for full credit.

Answers

Answer:

40 degrees

Step-by-step explanation:

Look at the attachment

If there are 7 people in a family, 4 grandparents, a grandchild a mom and dad, what is the average age of each person, if all together they are 381 years old?

Answers

Answer: 54.43

Step-by-step explanation:

381 / 7

Solve this system of equations using substitution:
y = 2x - 4
x + 2y = 10

Answers

Answer:

x + 2y = 10 = x + y = 5

Step-by-step explanation:

x + 2y = 10

divide 2 by 10

x + y = 5

This is all I really know how to do sorry  

Declan says that for any number n, the product 4x n is greater than 4. Which value of n shows why Declan is incorrect

Answers

Answer:

[tex]n > 1[/tex]

Step-by-step explanation:

Given

Statement: 4x n is greater than 4

Required

Value of n

First we need to rewrite the statement in algebraic form;

Product 4 * n is represented by 4n

greater than 4 is represented by > 4

Bringing these two together, it gives the following

[tex]4n > 4[/tex]

Divide through by 4

[tex]\frac{4n}{4} > \frac{4}{4}[/tex]

[tex]n > 1[/tex]

We've arrive at solution;

This means that n is greater than 1

So, the values of n must start from 2 to show that the condition is true

The value of n = 7/8 makes the inequality 4n > 4 false because 7/8 is less than 1.

What is inequality?

It is defined as the expression in mathematics in which both sides are not equal they have mathematical signs either less than or greater than, known as inequality.

We have n as a number.

4n > 4

Plug n = 5

20 > 4 (true)

Plug n = 9/5

36/4 > 4

9 > 4 (true)

Plug n = 3

12 > 4 (true)

Plug n = 7/8

28/8 > 4

3.5 > 4  (false)

Thus, the value of n = 7/8 makes the inequality 4n > 4 false because 7/8 is less than 1.

Learn more about the inequality here:

brainly.com/question/19491153

#SPJ5

A 20-inch bicycle has tires with a diameter of 20 inches. What is the circumference of these tires?


31.4 inches

62.8 inches

314 inches

1256 inches

Answers

Answer:B

Step-by-step explanation:

c=2nr  or c=nd

2*3.14 * 10= 62.8

3.14 * 20= 62.8

The circumference of the tires is 62.8 inches.

What is Circumference?

Circumference of a circle is defined for non straight curves which is the length of the boundary of the curve.

Given that, a 20-inch bicycle has tires with a diameter of 20 inches.

Diameter of the tire = 20 inches.

Radius of a circle or a circular object is half of the diameter of it.

Radius of the tire = 20 / 2 = 10 inches

Circumference of a circular object = 2πr, r is the radius.

Circumference of the tire = 2π r

                                          = 2 (3.14) (10)

                                          = 62.8 inches

Hence the circumference of a bicycle tire is 62.8 inches.

Learn more about Circumference here :

https://brainly.com/question/4268218

#SPJ6

A runner won a 100-meter race with a time of 9.73 seconds. How can you use place value to explain this time?

Answers

Answer: The runner is going exactly 10.2774922919 meters per second

Step-by-step explanation: Using the ratio 100:9.73, we can simplify that to 10.2774922919:1

Is this angle acute right obtuse or straight

Answers

Answer:

obtuse

Step-by-step explanation:

Over 90 degrees

Answer:

Obtuse

Step-by-step explanation:

The angle is obtuse because the angle is more than 90 degrees.

Can someone explain this step by step

Answers

Answer:

Step-by-step explanation:

[tex]1)\sqrt[4]{81h^{4}}=\sqrt[4]{3*3*3*3*h^{4}}\\\\=\sqrt[4]{3^{4}*h^{4}}\\\\ =3*h\\\\=3h[/tex]

Median income is the
A. the middle income reported
B. income in the middle of the data set when incomes are arranged from least to greatest
C. total incomes reported divided by the total number of people surveyed
D. income reported most frequently

Answers

The answer might be B

Median income is the income in the middle of the data set when incomes are arranged from least to greatest.

What is the median income?

Median is a measure of central tendency that is used to describe the number that is in the middle of a set of numbers that are arranged either in ascending or descending order

For example, the income of 3 workers for march are : $1000, $5000, $10,000. The median income is $5000.

To learn more about median, please check: https://brainly.com/question/14746682

#SPJ2

The regular hexagon has a radius of 4 in.
What is the approximate area of the hexagon?
O 24 in.2
0 42 in.2
048 in 2
084 in 2
4 in

Answers

Answer:

42

Step-by-step explanation:

A=33

2a2=3·3

2·42≈41.56922

Answer:

42

Step-by-step explanation:

priya finds (1.05) x (2.8) by calculating 105 x 28 then moving the decimal point three spaces to the left

Answers

Answer:

Yes, That is correct.

Step-by-step explanation:

Example: Multiply 0.05 by 1.1

start with:

 0.05 × 1.1

multiply without decimal points:

 5 × 11 = 55

0.05 has 2 decimal places,

and 1.1 has 1 decimal place,

so the answer has 3 decimal places:

 0.055

Priya's method easy finds the product of decimals because multiplying whole numbers is easier than multiplying decimal numbers.

Given that, Priya finds (1.05) × (2.8) by calculating 105 × 28 and then moving the decimal point three spaces to the left.

We need to explain why Priya's method makes sense.

How to multiply two decimals?

To multiply decimals, first, multiply as if there is no decimal. Next, count the number of digits after the decimal in each factor. Finally, put the same number of digits behind the decimal in the product.

Now, 105 × 28 = 2,940

Moving the decimal point three spaces to the left, we get 2.940.

Also, (1.05) × (2.8) =2.940

Therefore, Priya's method easy finds the product of decimals, because multiplying whole numbers is easier than multiplying decimal numbers.

To learn more about the multiplication of decimal numbers visit:

https://brainly.com/question/11162176.

#SPJ2

Your question is incomplete, probably the complete question/missing part is:

Priya finds (1.05) × (2.8) by calculating 105 × 28 and then moving the decimal point three spaces to the left. Why does Priya's method make sense?

What is the surface area of this design?

Answers

Answer:

This is a trick question- It is actually not hard to get to 440! Here's how:

You probably already know that the tall rectangles take up 4×(5×8)=160 of surface area, and that the short rectangles take up 4×(2×10)=80 of surface area. This looks like an office building so let's call it one.

You probably also saw the big, 10×10=100 inch area underneath the design.

BUT, did you know that the small, 5×5 inch square on top can be COMBINED with the weird, L-shaped flat-roof part in the middle? That's right! the 5×5 inch square can be seen as part of a full 10×10 inch square sitting on top of the short, wide rectangles.

If you look at the L-shaped flat roof, you can see that it's actually 3 more 5×5 squares. You need to connect the 10-inch dimension on the bottom with the 5-inch one on the top.

SO, the answer is gonna be:

160 in² in tall rectangles, +

80 in² in short rectangles, +

100 in² on the bottom, +

100² on the combined top small square and corner roof

Add those all up using some quick maths, and you get 440 in².

Some more details if you're still confused:

The sides of the tall rectangle? It's 5 inches by 8 inches, so each side 8×5=40 in². They go all around the tall box, so there are 4 of them. 40+40+40+40=160, or in other words, 40×4=160.

Do you see the short, wide rectangles on the bottom? they're 10 inches by 2 inches each, so each one is 2×10=20 in². They also go all around the short box, so they add up to 20+20+20+20=80, or in other words, 20×4=80.

Now I want you to think about the bottom of the design, underneath. It is 10 inches by 10 inches, so it is 10×10=100.

Finally, the small square on top of the tall rectangle, and that L-shaped part. Together, they make another 100, or 5×5 on top plus 5×10 + 5×5 again for the parts of the L-shaped roof, or 25+50+25, which equals 100.

What is the mean absolute deviation of this data set? 26, 31, 32, and 39

Answers

Answer:

3.5

Step-by-step explanation:

26, 31, 32, and 39

First we need to find the mean

(26+ 31+ 32+ 39) /4

128/4 = 32

The mean absolute deviation is sum of   the positive difference between the number and the mean  divided by the number of terms

((32-26)+ (32-31)+ (32-32)+ (39-32)) /4

14/4

3.5

The amounts of Cathy’s last six clothing purchases were $109, $72, $99, $15, $99, and $89. For each question, choose the mean, median, or mode and give its value.



C.) Which value would Cathy NOT tell her parents to convince them that she needs an increase in her allowance?



{I only need help on part C}

Answers

Answer:

The mean value = $80.5

Step-by-step explanation:

The value of her last six spendings are $109, $72, $99, $15, $99, and $89.

For the mean.

Mean = Total spendings/number

Mean =483/6

Mean = $80.5

For the median.

Lets arrange it in ascending order

$15 ,$72, $89, $99, $99, $109

The middle values are two.

Median = (89+99)/2

Median = 188/2

Median = $94

For the mode

$15 ,$72, $89, $99, $99, $109

Highest occuring is $99 with two frequencies.

To convince her parents that she needs an increase in allowance she would show them the bigger spendings .

So the least value on the list it's mean value which is $80.5.

Use the tool to measure the sides and angles of the triangles. Triangle XYZ is the pre–image. Are the triangles similar? Yes, No, Not Enough Information. If so, what is the scale factor going from triangle PQR to triangle ZYX? 1/4, 1/2, 2, cannot be determined

Answers

Answer:

Yes, 2

Step-by-step explanation:

Got it right on Edge 2020

Answer: 1: YES 2: 2

Step-by-step explanation:

How to change miles per hour to feet per second?

Answers

Answer:

1 mph = 1.46666667  fps

What is the surface area of this design?

Answers

Answer:

440 inches squared - the last option

Step-by-step explanation:

Step 1. Surface area of top square.

5 x 5 = 25 inches sq

Step 2. Surface area of the 4 sides of the cuboid.

5 x 8 = 40 inches sq

40 x 4 = 160 inches sq

Step 3. Surface area of the large square.

10 x 10 = 100 inches sq

100 - 25 (because it's being covered) = 75 inches sq

Step 4. Surface area of the 4 sides of the large flat cuboid.

2 x 10 = 20 inches sq

20 x 4 = 80 inches sq

Step 5. (OPTIONAL) Surface area of the bottom

10 x 10 = 100 inches sq

Step 6. Add up all.

25 + 160 + 75 + 80 (+ 100 if including the base) = 340

We can conclude that we have to include the base as well because 340 inches sq is not an option listed.

340 + 100 = 440 inches sq

440 inches sq is the last option

Hope this helps :)

what is the upper quartile in the box plot

Answers

Answer:

121

Step-by-step explanation:

Answer:

121

Step-by-step explanation:

Because it shows clearly that small box is 121

The radius of a soccer ball is 4 inches. Approximately what volume of air can it hold? Use 3.14 for Round to the nearest
tenth of a cubic inch,
Recall the formula Sphere V-
in
Mark this and retum
Save and Exit
Submit

Answers

Answer:

V =267.9 inch^3

Step-by-step explanation:

The volume of a sphere is given by

V = 4/3 pi r^3

V = 4/3 * 3.14 * (4)^3

V =267.946666666

Rounding to the nearest tenth

V =267.9 inch^3

Write and solve an inequality, You want to save at least $100. How much do you need to save if you start with $37?

Answers

Answer:

$63 is the answer

Step-by-step explanation:

100-37=63

i just need the work for 11 & 12. i know the answer for 11 is (16,4) and 12 is (5,7) but i don’t know how to work it out to get those answers. (solving a system of linear equations)

Answers

Answer:

Step-by-step explanation:let x be the number of bicycles,

let y be the number of tricycles

given x+y=20→equation 1

also given 2x+3y=44→equation 2

from eq 1, y=20-x

substitudin ineq 2

2x+3(20-x)=44

2x+60-3x=44

60-x=44

-x=44-60

=-16

x=+16

then y=20-16=4

no of bicycles=16

no of tricycles=4

hope this helps

plzz mark me brainliest

100 POINTS!!! NO JOKE!!! (IF YOU ANSWER THE QUESTIONS) It's a little time consuming but I want to see who can answer the fastest. I would really appreciate the answers to these asap. ONLY ANSWER IF YOU KNOW HOW TO DO THESE!!! They're easy but I don't want to do them.
Appreciate = Will mark Brainliest if correct
Thanks so much

Answers

Answer:

1. x = -4

  y = -20

2. x = -1

   y = 3

3. x = 7

   y = 4

4. x = -6.5

   y = -10.5

hope this helps :) sorry if I get it wrong!

Answer:

1) x=−4, y=−20

2) x=−1, y=3

3) x = 7 , y=4

4) x = -6.5 , y = -10.5

Step-by-step explanation:

1) y=5x;−3x+2y=−28

solving system by substitution:

substitute y =5x into 2nd equation:

-3x +2*5x =-28 → -3x+10x = -28 → 7x = -28 → x = -4

plug in  x in any equation and solve for  y = 5* -4 = -20

2) solving system by elimination:

Multiply the first equation by 7, and  the second equation by 5.

7(4x−5y=−19)

5(3x+7y=18)

----------------------

28x−35y=−133

15x+ 35y= 90

Add them up to eliminate y:

43x=−43 divide both sides by 43

x=−1

plug x back into 1st equation to solve for y

4x−5y=−19

(4)(−1)−5y=−19

−5y−4=−19 add 4 to both sides

−5y=−15 divide by -5

y=3

3) y =4 , 5x -6y = 11

plug in 4 for y in 2nd equation and solve for x:

5x -6* 4 =11 simplify

5x - 24 = 11 add  24 on each side

5x = 11 +24 simplify

5x = 35 divide by 5 on each side

x =7

4) y = x -4, 2x - y = -2.5

use substitution method:

2x -(x-4) = -2.5 distribute ( )

2x-x+4 = -2.5 simplify

x + 4 = -2.5 subtract 4 on each side

x = -2.5 -4

x = -6.5

plug in -6.5 for x in 1st equation and solve for y:

y = -6.5 -4

y = -10.5

Which number sentence is true?
A. 78 = 68
B. 78 < 69
C. 78 = 75
D. 78 < 81
E. 78 > 84​

Answers

Answer: the answer choice “d” is correct

Step-by-step explanation:

because the different symbols mean different things and yeah

Answer:

D

Step-by-step explanation:

lesser value -------    < --------This side bigger value {open mouth}

78 < 81

81 is bigger than 78

The volume of this square pyramid is 200in^3. Find the value of x.

Answers

Answer:

x = 5 in.

Step-by-step explanation:

Volume = 1/3 * area of the base * height

200 = 1/3 * 8*15 * x

200 = 40x

x = 5 in.

while abbie is jogging she moves forward 85 cm every second how many seconds will abbie take to jog 8.5 meters

Answers

Answer:

85 cm = .85 meters

8.5 / .85 = 10 seconds

Step-by-step explanation:

Twenty people apply for an open position at an accountant's office. The distribution of ages of the applicants is shown in the box plot.

Distribution of Applicant's Ages

How many of


age in years

the applicants have ages that fall within the box of the box plot?


Please help!!!!

Answers

Answer:

The number of applicants that have ages that fall within the box of the boxplot = 10.

Step-by-step explanation:

box plot is constructed from five values: the minimum value, the first quartile, the median, the third quartile, and the maximum value.

The boxplot usually consists of a box and a whisker plot.

The whiskers represent data that is less than the first quartile or 25th percentile and data that is more than the third quartile or 75th percentile.

The box of the boxplot is bounded by the first quartile or 25th percentile and the third quartile or 75th percentile.

Hence, the fraction of the distribution that is usually contained in the box of the boxplot is (75 - 25), 50% of the distribution.

The total number of applicants = 20

50% of 20 = 10.

Hence, the number of applicants that have ages that fall within the box of the boxplot = 10

Hope this Helps!!!

The sum of two numbers is −21. One number is 55 less than the other. Find the numbers.

Answers

Answer:

x = 17     y= -38

Step-by-step explanation:

x + y = -21

y = x - 55

It doesn't matter whether x or y is 55 less than the other right now.

substitute for y:

x + x - 55 = -21

solve for x:

2x = 34

x = 17

solve for y:

17 + y = -21

y = -38

On a coordinate plane, a curved line crosses the x-axis at (negative 1, 0) and crosses the y-axis at (0, 0.25). The line exits the plane at (negative 2, negative 6) and (2, 6). Which statement is true about the end behavior of the graphed function?

Answers

Answer:

b

Step-by-step explanation:

hope this helps

Answer:

b

Step-by-step explanation:

Yehudy invested $19.250 in a simple interest account. After 6 years and no additional deposits or withdrawals, the account balance was
$22.957.55. Find the interest rate for the account. Round to the nearest hundredth of a percent if needed

Answers

Answer: 3.21%

Step-by-step explanation:

Interest = (1/t)(A/P - 1)

Other Questions
Evaluate 9 b 9b9, minus, b when b = 8b=8b, equals, 8. what is the degree of x^4-3x+22 How does the American work week compare to the rest of the world? Is this better for US or them? Defend your answer with facts. EquationsWhat is the solution of the system of linear equations?-3x + 4y = -182x - y = 7(-2,-3)(-2,3)(2, -3)(2, 3) How does the narrator repeating My favorite at the beginning of every paragraph contribute to the story? (My favorite things by joy cowley) can anybody give me some options and some tips for my portfolio poem. for school. free verse poem. Take 2 y2 - 3 y - 5 from y3 - 6 y2 + 5 y . Select the correct answer.A) y3 - 2 y2 + 3 y + 5B) y3 - 4 y2 + 2 y - 5C) y3 - 4 y2 + 2 y + 5D) y3 - 8 y2 + 8 y + 5 How many Liters are in 17.3 moles of Iron? What is the volume of a rectangular prism with a length of 2 inches, a width of an inch & is a quarter of an inch in height? Is the below sequence DNA or RNA? How do you know?GTTTACAGGCGGCGCAATATCTGATCG Identify the vertex of the function graphed below.A. (1,2)B. (2,-1)C. (3,-2)D. (0,7) In the 1994 elections, Republicans won a clearmajority in states. Help asap!!! GIVING BRAINLIST Which characteristic of the father had the MOST influence on the action of the plot?A)angerB)courageC)fearD)gratitude A pink crayon is made with 12\text{ mL}12 mL12, start text, space, m, L, end text of red wax for every 5\text{ mL}5 mL5, start text, space, m, L, end text of white wax Can you help me please What was the effect of Thomas Paine's pamphlet Common Sense?A. It argued that women should be given the right to vote.B. It persuaded colonists to abolish slavery.C. It explained the benefits of westward expansion.D. It encouraged colonists to fight for independence. 1. Summarize the scientific information that leads to conservation in each of the articles.2. What social issues affected the problem or its solution in each of the stories?3. How did economics delay scientists' first attempts for conservation in each story?4. Describe the political actions that led to successful conservation in both stories. Which trend in hominid evolution can be supported by fossil evidence?Walking uprightUse of toolsIncreased intelligenceDecorating cave walls Find the hypotenuse of each Isosceles right triangle when the legs are of the given measure.Given = 6squareroot2