Inherited used in a sentence

Answers

Answer 1
I inherited my parents genes.

Related Questions

Which of the following foods are native to rainforests?
a. papayas
b. mangoes
c. Sugarcane
d. all of the above

Answers

Answer:

on edge here's the correct answer

Explanation:

Answer: It is D)

Explanation:

If a hydrocarbon chain has a carbon to carbon double bond then it is _______________.

Answers

Answer:

It is Alkene..........

Answer:

Alkenes

Explanation:

Alkene is a hydrocarbon chain that has a carbon to carbon double. Alkenes are considered 'acyclic' because it has one carbon to carbon double. Since they contain less than a maximum number of hydrogen atoms they are unsaturated.

Hope this helped    

write a short paragraph on hydra​

Answers

Answer:

at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)

Explanation:

Hydra are simple invertebrates, with two layers of body cells. They live in fresh water. Their body is radially symmetric. They have a central cavity through which they take in food and expel waste.

Why are some theories more widely accepted than others such as the theory of evolution?

Answers

Answer:

Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.

Explanation:

I majored in Biology

Which is one of Edwin Hubble’s findings that supports the big bang theory?

The universe started at a central point.
Planetesimals formed in debris disks.
Visible matter only makes up about 5% of the universe.
The Milky Way is the only galaxy in the universe.

Answers

Answer:

A

Explanation:

“Fish and other wildlife become unhealthy and die without __________.”

Oxygen
Carbon Dioxide
Eutrophication

(This is 7th grade science)

Answers

Answer:

Oxygen

Explanation:

Andwer is oxygen if not then eutrophication

Why is biodiversity important for ecosystems?

Answers

Answer:to stop from extinction

Explanation:

Why are bananas curved?

Answers

Answer:

It's because of the sun! Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'.What it means is that bananas grow away from the ground, instead of growing towards it, hence the 'negative' geotropism.

Explanation:

g.o.o.g.l.e lma o

Answer

It's because of the sun!

Explanation:

Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'. Meaning it grows away from the ground instead of towards it.

Which of the following solutions is neutral?


Group of answer choices


a solution with a pH of 14


a solution with a pH of 2


a solution with a pH of 7


a solution with a pH of 9


Flag this Question

Question 4

Potassium hydroxide has the chemical formula KOH. It feels slippery and is used in cleaning liquids. Based on this description, potassium hydroxide is most likely a(n)?


Group of answer choices


acid


base


neutral solution


pH indicator








first to answer gets the brinllest

Answers

Answer:

Kleenex

ekekkdkdkeeee

The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.

What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?

An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.

Answers

The question to the above information is;

What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?

Answer;

An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.

Explanation;

-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.

J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:

atoms are spheres of positive chargeelectrons are dotted around inside

Answer:

Its C on edge

Explanation:

list one part of the cell theory in your own words, explain what it means

Answers

One part of the cell theory is that pre-existing cells can form more cells

This means that cells that currently exist are capable of creating more cells, however it’s a slow process

Eukaryotic cells can be specialized for specific tasks in multicellular organisms

true
false

Answers

It is true from my looking

Which plant propagation process insures some genetic diversity?

Answers

Answer:

Seed propagation takes place during sexual reproduction. The production of seeds through auto-pollination or crossed pollination ensures some genetic variation.

Explanation:        

Seeds ensure the existence of genetic variation between plants. There are two general crossing systems in plants, which depend on pollination type.  

Self-pollination occurs when the flower pollen is transferred to the same flower stigma, reaching that individual egg to fertilize it. These are autogamous systems. Crossed pollination occurs when the mature pollen is driven by different pollinator agents from one flower to another, reaching the other flower stigma and fertilizing its eggs. These are xenogamous systems.

Sexual reproduction gives more possibilities to different alleles of a gene that did not appear in one generation to express in the next generation. Both types of pollination allow genetic variation, however by the occurrence of crossed pollination there are more chances to ensure the variability of the species and survival to environmental changes. While by self-pollination there are more chances to express the same genotype of the parental plant. The Xenogamous system has the advantage of avoiding the effects of endogamy in a population.

Which of these describes a way in which humans could increase biodiversity in a marine ecosystem? A. They could introduce new species to the ecosystem. B. They could limit fishing to only one kind of fish in the ecosystem. C. They could ban boating,snorkeling,and scuba diving in the ecosystem. D. They could restrict the amount of each type of fish or shellfish harvested from the ecosystem

Answers

I’m thinking D. But A also looks like it could be right

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

An example of __ is the color of betta fish. When a RED fish (GG) is crossed with a YELLOW fish (gg), all of the offspring will be a ORANGE color (Gg)

Answers

Answer:

The correct answer is  - incomplete dominance.

Explanation:

In the betta fish, there are different types of colors found in the fishes depends on the alleles present in their gene which follows incomplete dominance. Incomplete dominance is an inheritance pattern where a dominant allele does not mask completely and produce a blend of both alleles if present in heterozygous condition.

In the question, It is stated that when a cross between RED fish (GG) and a YELLOW fish (gg) produce orange color fish as offspring (Gg) which is a mix or blend of both alleles Red (dominant) and yellow (recessive).

Which statements accurately describe fermentation? Select two options.

Oxygen is present during this process.
Cells may convert pyruvic acid to lactic acid.
NAD+ is converted to NADH.
Fermentation is an anaerobic process.
Additional ATP is produced after glycolysis.

Answers

Answer:

The answers are the second and fourth ones.

Explanation:

I did the assignment.

The statements that accurately describe fermentation are cells may convert pyruvic acid to lactic acid, and fermentation is an anaerobic process. The correct options are B and D.

What is fermentation?

Fermentation is an anaerobic chemical process that breaks down molecules like glucose. More specifically, fermentation is the bubbling that happens during the creation of wine and beer, a procedure that has been around for at least 10,000 years.

It is different from aerobic respiration because it occurs in the absence of oxygen and aerobic respiration occurs in the presence of oxygen. The product of fermentation is lactic acid, which is produced from pyruvic acid.

Thus, the correct options are: B, Cells may convert pyruvic acid to lactic acid, and D, Fermentation is an anaerobic process.

To learn more about fermentation, refer to the link:

https://brainly.com/question/14525128

#SPJ6

17. What causes evaporation?
O Air that is unsaturated with water vapor comes into contact with the surface of the water
O Air that is cooler than the water comes into contact with the surface of the water
O Air that is warmer than water comes into contact with the surface of the water
O Air that is supersaturated with water vapor comes into contact with the surface of the water in

Answers

the answer is the first one

Evaporation occurs when air that is warmer than water comes into contact with the water's surface, hence option A is correct.

What is evaporation?

As a liquid transforms into a gas, evaporation, a sort of vaporization, occurs on the liquid's surface. For instance, a high concentration of the evaporating substance in the surrounding gas significantly slows down evaporation when humidity affects the rate of evaporation of water.

It takes in moisture from garden soil as well as the biggest lakes and seas, and the level of the water will decrease when it is heated by the sun.

Therefore, solar energy, or heat from the sun, is what causes the evaporation process to occur, hence option A is correct.

Learn more about evaporation, here:

https://brainly.com/question/5019199

#SPJ5

How does the force of gravity move objects in the solar system?

Answers

Answer:

One of the most noticeable effects of gravity in the solar system is the orbit of the planets. The sun could hold 1.3 million Earths so its mass has a strong gravitational pull. When a planet tries to go past the sun at a high rate of speed, gravity grabs the planet and pulls it towards the sun

Explanation:

please help i will give brainlist

Answers

Answer:

I think it's c hope I hope I helped if not I'm sorry:(

Option B is i hope
I think it is

what is a global fire

Answers

Answer:

a wild fire of a spreading fire that reaches a global span

Explanation:

Fireeeeeeeeeeeeeeeee

Who is to blame climate change?
Scientists have measured global temperatures for over a hundred years and see that the Earth is getting hotter. Ice core data suggests the Earth should actually be cooling if it were following its natural cycles. The trend can be best visualized by comparing each year’s average temperature with the long- term average. Figure 1 shows observations of the world’s annual average temperature made by the National Oceanic and Atmospheric Administration (NOAA). In recent decades, the years have always been hotter.
Over geologic time, the Earth’s average temperature has changed as a result of the sun’s output, the tilt and position of the Earth in its orbit, and the concentration of greenhouse gases. Scientists have developed a good understanding of the natural variations in these factors by examining different data sources in order to estimate ancient temperatures. Observations tell us that these natural factors have not been changing over the last hundred years or so in a way that would explain the observed temperature increases.
In contrast, greenhouse gases have been changing in a way that can explain the observed temperature increases. Figure 2 shows the change in atmospheric CO2 concentration over the last thousand years. At the Scripps Institute of Oceanography in Hawaii researchers have been sampling pristine mountaintop air every month since 1958. Their observations show that both the concentration and isotopic composition of CO2 is changing, and is consistent with manmade sources, including the carbon emissions from burning fossil fuels. The industrial revolution marked a drastic increase in CO2 concentrations in the atmosphere when humans began using fossil fuels on a large scale.
Scientists attribute the global warming trend observed since the mid-20th century to the human expansion of the "greenhouse effect"1 — warming that results when the atmosphere traps heat radiating from Earth toward space. Certain gases in the atmosphere block heat from escaping. CO2 along with other gases are known as greenhouse gases. Over the last century the burning of fossil fuels like coal and oil has increased the concentration of atmospheric CO2. In its Fifth Assessment Report, the Intergovernmental Panel on Climate Change, a group of 1,300 independent scientific experts from countries all over the world under the auspices of the United Nations, concluded there's a more than 95 percent probability that human activities over the past 50 years have warmed our planet.
Give evidence and reasoning!!

Answers

Answer:

People

Explanation:

The energy we use and waste

Select the letter of the correct answer.
Growers around the world produce about 3.2 x 107 metric tons of sunflowers each year. One
metric ton is the same as 1.1 short tons. How many short tons of sunflowers do worldwide
growers produce annually?

Answers

Answer:

3.5264 x [tex]10^{7}[/tex]

Explanation:

The metric ton is used as a unit of mass. The metric ton in British units can be represented as 2240 pounds or long ton whereas in United state is termed as 1.102 short ton.

In the given question, it has been mentioned that the growers around the world produce about 3.2 x [tex]10^{7}[/tex] a metric ton of sunflower.

So the short ton produced will be

= ( 3.2 x [tex]10^{7}[/tex] ) x 1.102

= 3.5264 x [tex]10^{7}[/tex] short ton.

Thus, 3.5264 x [tex]10^{7}[/tex] is the correct answer.

Which of these is an advantage of fossil fuels? *

O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable





Answers

Answer:

reliable

Explanation:

Explanation:

Fossil fuels are a non-renewable resource.

What is the purpose of the other tube of water?

Answers

Explanation:

cant see photo

Answer:

delude the other thing

there is no picture so i have no idea what your asking. ill edit this answer to be more specific when you explain

Explanation:

The formation of an ionic bond involves the
Select one:
O sharing of neutrons.
sharing of protons.
transfer of neutrons
transfer of electrons

Answers

Answer: transfer of electrons

Explanation:

Why is weather different from place to place?​

Answers

Answer:

There are differences in climate around the world because of differing amounts of radiation received from the Sun at different parts of the Earth at different times of the year.

Explanation:

Hope this helps :)

Answer:

because according to where they are located, atmosphere brings different weather and temperature, and some places are further away from the sun, just like when it is day in one side but night on the other

Explanation:

Which statement best explains the myth about how Romulus and Remus founded Rome?

Answers

After deciding to build a town on one of seven hills, Romulus and Remus had to decide which hill to base it off of and Romulus chose Palatine hill and Remus chose Aventine Hill, Later leaving Romulus to kill Remus in a fight and build the city on Palatine hill hence the name Rome.

Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.

Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer

what RNA nitrogen bases match with the following DNA nitrogen bases?

Answers

While DNA has the ATCG nitrogenous bases, RNA replaces thymine with uracil, making its bases AUCG. So, that means that whenever DNA has adenine, instead of pairing this with thymine, RNA will use uracil instead.

I need help with this (last question I had had the picture all black)

Answers

Answer:

I only know A

I think it's the lap

Other Questions
14.976 divided by 6 with remainder Which statement accurately describes runners?A runner is a small underground stem that sprouts new buds.A runner is a series of underground leaves that contain stored food.A runner is a horizontal stem that grows along the ground.A runner is a horizontal stem that grows underground. Describe the difference between sociology and psychology.will mark you brainliest :) The cost of purchasing gasoline varies directly with the number of gallons purchased. Kali paid $52.90 for 23 gallons of gas. What is the direct variation equation that relates y, the cost of a gasoline purchase, to x the number of gallons? Add parentheses to the expression so that its value is 45:5 4 + 8 - 3no parentheses are needed5 (4 + 8 - 3)5 (4 + 8) - 35 4 + (8 - 3) PLZZZ HELPIn addition to how much force Earth exerts on the object, which features of an object affect its weight? A.mass and location of the objectB.shape and location of the objectC.location of the object and how much energy the object hasD.mass of the object and how much energy the object has You should be on the lookout for tornadoesduring___because the two often occurtogether.thunderstormswinter stormsblizzardshurricanes Prompt: On the ships anchored at Pearl Harbor this Sunday morning, men are sleeping, eating breakfast, relaxing on the sunny decks, or preparing to go ashore for last minute Christmas shopping. On the cruiser Helena, some of the Marines are getting ready for a softball game.For the second time in three hours, the Ward is on alert, having again detected a strange movement in the water. Upon closer inspection, Lieutenant Outerbridge is stunned to see a stubby black submarine, half submerged. He immediately orders the crew to sink it, and any other submarines they may find. Outerbridge radios the following message back to headquarters at Pearl Harbor:"We have attacked, fired on, depth-charged, and sunk submarine operating in defensive sea area."But the Lieutenant's message is decoded very slowly. No one knows to call an alert.*Depth charge - an explosive device designed to explode underwaterQuestion: Not knowing about the impending attack, what are the possible positive and negative outcomes of sinking this unknown stubby black submarine? text me (850)-814-8472. HELP PLEASE!!!!!!!!!Select the verb in the preterite tense that best completes the sentence.Mam, ya te ________ la medicina? tomaste tomas toman tomaron Kishauna rode her bike for 35 minutes each on Monday, Wednesday, and Saturday and 55 minutes each on Tuesday and Thursday. Choose the correct expression and answer that shows the total amount of time she spent riding her bike. Name4.BanltwoLine m is the perpendicular bisector of AB andintersects the segment at point P. Whichstatement is true?(A) AP = 2 ABPA & BP()AB = APBP = 2 AB what subtracted by 26 equals -102 Round 0.71 to the nearest tenth.0.50.70.750.8 2 lines that never intersect During Washington's first term, political factions disagreed over which issue:A - The nation's education system.B - changing currency to gold.C - ratification of the U.S. ConstitutionD - Alexander Hamilton's financial program Can someone plz help:( On a team 5 girls and 2 boys scored a total of 41 points. The difference between the number of points scored by the 5 girls and the number of points scored by the2 boys is 29. Each girl scored the same number of points and each boy scored the same number of points. Find the number of points scored by each girl and eachboyEach girl scored points DUE TOMORROW!!! 15 POINTS please help!! the answers are already given i just need to show work :( ive been stuck on this for an hour now Can someone Write a short narrative paragraph about snow (20 points)