In the following diagram, four different index fossils are labeled:

In this diagram, from top to bottom, an index fossil from the Jurassic period is labeled A, an index fossil from the Permian period is labeled B, an index fossil from the Devonian period is labeled C, and an index fossil from the Cambrian period is labeled D.

Public Domain

Which of the labeled fossils comes from the oldest organism?

A
B
C
D

In The Following Diagram, Four Different Index Fossils Are Labeled:In This Diagram, From Top To Bottom,

Answers

Answer 1

Answer:

D, the fossil in the Cambrian period

Explanation:

there are time periods on the left side that go from youngest on the top and oldest on the bottom

Answer 2

In the labeled diagram the fossils comes from the oldest organism an index fossil from the Cambrian period is labeled at the point D. Thus, option D is correct.

What is the index fossil about?

Index fossils, which is also known as the key fossils or the guide fossils, are fossils of the organisms that are used to help determine the age of rock formations and sedimentary strata. Index fossils are typically chosen because they are easily recognizable, widespread, and existed for a relatively short period of time.

They are used as "markers" for specific time periods, and the presence or absence of certain index fossils can help scientists determine the relative age of rock formations.

In this scenario, the index fossil labeled A is from the Jurassic period, which lasted from about 201 to 145 million years ago. The index fossil labeled B is from the Permian period, which lasted from about 299 to 251 million years ago.

Therefore, In the labeled diagram the fossils comes from the oldest organism an index fossil from the Cambrian period is labeled at the point D. Thus, option D is correct.

Learn more about  Fossils on:

brainly.com/question/10003854

#SPJ5


Related Questions

In the database, Academic Search Complete (Links to an external site.), search for the article "Brevetoxicosis: Red Tides and Marine Mammal Mortalities" by Flewelling et al. If you wanted to explore more of the scholarly conversation by taking advantage of "citation chaining" what links could you click on to help with this task

Answers

Answer: The link I would be clicking on with this task is Molecular detection of the brevetoxin-producing dinoflagellate Karenia brevis and closely related species using rRNA-targeted probes and a semiautomated sandwich hybridization assay. Therefore, the task will be accomplished having done this.

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

Which structure is located between the trachea and a bronchiole? A. epiglottis B. pharynx C. alveolus D. bronchus

Answers

the correct answer is the bronchus

PLEASE ANSWER ASAP!!!!!!!! ITS DUE IN 5 MINUTES.

1.) How do organisms benefit from Mitosis? Write a paragraph using at least five sentences.


Answers

Answer:

Organisms benefit from mitosis because mitosis helps regenerate cells. This helps them recover from injuries and more.

Explanation:

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

What are intermediate species? in an easy way to understand. And some examples?

Answers

Answer:

An intermediate is a species which appears in the mechanism of a reaction, but not in the overall balanced equation. Examples: Amphibian/land vertebrate (Pederpes)- Intermediate form between primary aquatic Upper Devonian amphibians and early tetrapods. Lizard/snake (Pachyrhachis)—Intermediate form of snakes and an extinct lizard-like reptile. It was a primitive snake with limbs.

Explanation:

Answer: These are certain species that create “connecting links” or something like that, between the fossil record of life which help to show the slow process of speciatin.

[speciatin- the formation of new and distinct species in the course of evolution.]

Hope this helped! <3

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

what mode of nutrition is house fly​

Answers

Answer:

Houseflies do not have chewing mouthparts like a cockroach or piercing-sucking mouthparts like a mosquito. They regurgitate digestive enzymes, soften and liquify the food material, and then they sop it up with their sponging mouthparts.

Hope this makes sense and helps

When human skin suffers a cut, the process of healing rapidly begins allowing for wound closure and healing within a few days. Keloids occur when skin around wounds continues to grow after the skin has healed. A disruption in the regulation of which cellular process is probably responsible for this condition

Answers

Options

A. Mitosis

B. Meiosis

C. Apoptosis

D. Phagocytosis

Answer:

A

Explanation:

Mitosis is a type of cell division which takes place in living  organism during growth and development.Therefore it is ensures  the regenerations of cells and tissues during healing.

Therefore the restoration of new cells to the skin following injuries is due to mitosis.Since this is a multiplication division(2n) in which the daughter cells are exactly like the parents' cells the new tissues of the skin by mitosis, look exactly like the previous one that was injured.

In cases where the mitotic growth control is lost, the scare tissues of the injured part overgrows with granulation tissues and this leads to Kaloids.

      Its is a mass of Collagen Type 1.(Collagen is an  fibrous proteins  which has largest proportion in mammals).

Keloids  is characterized with pink or red coloration and elevation of the area,excessive growth of the area, with irritating  patch skin

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

Can someone describe these:
Menstrual Phase
Follicular Phase
and Luteal phase

Thanks!!!

Answers

Answer:

(menstrual phase) this is the phase where the unfertilized ovum and endometrium that was formed in readiness for implantation slough off or come out due to a sudden drop in progesterone levels

(follicular phase) this is where the graafian follicle in the ovary develops. from primary follicles due to secretion of follicle stimulating hormone by the pituitary gland and matures there after due LH hormone which will also stimulate the ovary to release the ovum

(luteal phase)this is the phase after the ovum has been released where the remains of the ruptured graafian follicle undergo reorganization to form a corpus luteum/yellow body which now produces progesterone which causes thickening of endometrium in readiness for implantation

hope this helps

Answer:

The menstrual cycle is the regular natural change that occurs in the female reproductive system that makes pregnancy possible. 2) The follicular phase is a phase of the estrous cycle during which follicles in the ovary nature from primary to a fully mature grafian follicle.It ends with ovulation.3) The luteal phase begins during the second half of a menstrual cycle normally lasting around 12 14 days after the ovulation and it is responsible for producing progesterone.

Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

The dark organelles labelled E is called the Ribosomes.    

The answer is Ribosomes

Drag each label to the correct location. Classify the interactions as being direct or indirect competition. Two eagles fight over a salmon carcass. All the gray foxes in a habitat prey primarily on penguins. Two colonies of black ants clash over a wasp. Gray squirrels in an area rely on nuts for food.

Answers

Answer:

Two eagles fight over a salmon carcass- DIRECT

All the gray foxes in a habitat prey primarily on penguins- INDIRECT

Two colonies of black ants clash over a wasp- DIRECT

Gray squirrels in an area rely on nuts for food- INDIRECT

Explanation:

Living organisms of same or different species tend to interact with one another in their natural habitat. One of those interactions is competition, which occurs when living organisms share the same limited resources or occupy the same niche in their habitat.

However, competitive interaction between organisms can either be direct or indirect. Direct interaction is that which involves a physical interaction between the organisms i.e. a confrontation. A struggling for the limited resource is evident. For example, two eagles fighting over a salmon carcass and two colonies of black ants clashing over a wasp shows the form of physical confrontation for the limited resource between the organisms involved. Hence, they are examples of direct competition.

On the other hand, indirect competition involves the competition for a limited resource without a physical confrontation or struggle. Organisms make use of the limited resource until it becomes unavailable to competitors. For example, gray foxes in a habitat that prey primarily on penguins and gray squirrels in an area relying on nuts for food shows a competition for a scarce resource without any physical interaction between them. Hence, they are examples of indirect competition.

Write TRUE or FALSE
(a)
A 'system' is the part of an organism that carries out a certain function.​

Answers

Answer:

TRUE

Explanation:

True or False: Polar molecules do not have a difference in electrical charge.

Answers

Answer:

false

Explanation:

nonpolar molecule has no separation of charge, so no positive or negative poles are formed

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

After school, Kai feels hungry and tired. He finds some sugar cookies in the cabinet and finishes the whole package.
Which statements best describe the role of glucagon and insulin in this scenario?
O Glucagon was secreted by his pancreas before he ate the cookies because his blood glucose was low. Insulin
was secreted after he ate the cookies because his blood glucose was high.
O Insulin was secreted by his pancreas before he ate the cookies because his blood glucose was low. Glucagon
was secreted after he ate the cookies because his blood glucose was high.
O Glucagon was secreted by his pancreas before he ate the cookies because his blood glucose was low. After he
ate, insulin from the cookies increased his blood sugar levels.
O Insulin was secreted by his pancreas before he ate the cookies because his blood glucose was low. After he ate,
glucagon from the cookies increased his blood sugar levels.

Answers

Answer: Option A) Glucagon was secreted by his pancreas before he ate the cookies because blood glucose was low. Insulin was secreted after he ate the cookies because his blood glucose was high.

Explanation:When Kai was hungry and his blood glucose level was decreasing, glucagon is the hormone which was secreted by the islets of pancreas to increase the blood sugar levels in his body. Glucagon forces the liver to release the stored glucose in it, which increases the blood glucose level in the body. When Kai ate the sugar cookies there was enough of blood glucose available for his body, also it exceeded the requirement and went high. Insulin was then secreted to control this excess glucose from the islets of pancreas. As it helps the body cells to absorb the glucose and lowers the amount of glucose in the blood. It makes the cell available with the glucose to produce energy and perform their activities.

In short, glucagon and insulin both are secreted by the same organ which is islets of pancreas. But they differ in their function, glucagon increases the blood glucose when the body needs it, whereas insulin helps to absorb the excessive glucose and stores that in the body. Both are the hormones which help in regulating the body glucose levels.

During  process of digestion which takes place in digestive tract statement which describes role of glucagon and insulin is glucagon was secreted by  pancreas before he ate the cookies because his blood glucose was low. Insulin was secreted after he ate cookies because his blood glucose was high.

What is digestive tract?

It consists of the gastrointestinal tract along with the accessory organs which are present in digestion process . It involves the breakdown of complex food into smaller components which can be easily assimilated and absorbed by the body.

The digestion process has 3 phases: cephalic phase , gastric phase and intestinal phase.Cephalic phase begins with secretion of gastric juices from gastric glands in response to sight and smell of food.It involves chewing and chemical breakdown of food by the action of digestive enzymes ,saliva in the mouth contain enzymes like lipase and amylase which are secreted by the salivary and serous glands present on the tongue.

Learn more about digestive tract,here:

https://brainly.com/question/28163067

#SPJ2

Which function is specific to the neuron? It generates electrochemical signals so that the body can react to stimuli. It produces antibodies to destroy pathogens for protection purposes. It breaks down chemical substances into a form that is usable by the body. It delivers oxygen to the cells of the body for metabolic processes.

Answers

Answer:

It generates electrochemical signals so that the body can react to stimuli.

Explanation:

This is the job of the nervous system; it allows our body to react to stimuli. Neurons are what allows us to feel if something is touching our body (or if we are touching something) by sending synapses all the way to the brain at an incredibly fast pace.

Answer:

It generates electrochemical signals so that the body can react to stimuli.

Explanation:

edge 2022

Evaluate this statement: Gene flow increases the genetic divergence of populations. Evaluate this statement: Gene flow increases the genetic divergence of populations. This statement is true. This statement is false. Gene flow is not able to influence the genetic divergence of populations. This statement is false. Gene flow reduces the divergence of populations. This statement is false. Gene flow increases the number of genes in populations.

Answers

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

Explanation:

In biology and related areas, genetic divergence occurs if populations with a common ancestor develop unique traits, which are the result of genetic changes over time. On the other hand, gene flow occurs when traits including genes flow from one population to another, usually because the populations are in contact. In this context, gene flow reduces divergence because if genetic material flows between populations is less likely each population can develop unique traits, instead the populations involved will have similar traits after some time.

The correct answer is C. This statement is false. Gene flow reduces the divergence of populations.

The following information should be considered;

In terms of biology and related areas, genetic divergence arise at the time when the populations are with a common ancestor that created unique traits, due to this there are genetic changes over time. While gene flow arise at the time when traits involved genes flow from one population to another, normally due to the populations are in contact. In this given situaton, gene flow reduces divergence since genetic material flows between populations is less likely every population can create unique traits, rather the populations involved will have similar traits.

Learn more: https://brainly.com/question/5303391?referrer=searchResults

Shivering and vasoconstriction would be signaled to cause a: A. increase in pH. B. decrease in temperature. C. decrease in pH. D. increase in temperature.

Answers

Answer:D

Explanation: shivering occurs when someone is cold and vasoconstriction is when the blood vessels close to the skin and the veins closer to the skin surface constrict as a result of dat air doesn’t enter the body

Vasoconstriction is the narrowing of the blood vessels that hinders blood flow. Vasoconstriction and shivering will lead to an increase in the temperature through thermoregulation. Thus, option d is correct.

What is thermoregulation?

Thermoregulation is the maintenance and balancing of the temperature and heat in the body. They are regulated by many factors including shivering and vasoconstriction.

During the vasoconstriction, the blood vessels close to the skin surface close and the body shivers as a result of cold or decreased temperature. This signals the body to increase the temperature so that shivering can be stopped.

Therefore, vasoconstriction and shivering signal the body to increase the temperature.

Learn more about thermoregulation here:

https://brainly.com/question/7450241

#SPJ2

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

Use the image to answer the question below: Using the model presented, what process is being depicted? A) An electrical signal being converted to a chemical signal B) Salutatory conduction C) The transfer of neurotransmitters between axons D) The path of a steroid hormone

Answers

Answer:

option A is correct because of it is undergoing a convertion

Is there just one universal scientific method?

Answers

Answer:

There is no such unique standard method—scientific progress requires many methods—but students in introductory science courses are taught that `The Scientific Method' is a straightforward procedure, involving testing hypotheses derived from theories in order to test those theories.

Explanation:

Other Questions
During an extravagant banquet Belshazzar saw a divine handwritten message that appeared on the plaster wall of the palace. This message indicated that his kingdom had been numbered, weighted, and divided.a. Trueb. False The currency drain ratio is 0.5 of deposits and the banks' reserve ratio is 0.4. What is the money multiplier? I need help with five math questions please help A research center claims that % of adults in a certain country would travel into space on a commercial flight if they could afford it. In a random sample of adults in that country, % say that they would travel into space on a commercial flight if they could afford it. At , is there enough evidence to reject the research The dot plot represents a sampling of ACT scores: dot plot titled ACT Scores with Score on the x axis and Number of Students on the y axis with 1 dot over 24, 3 dots over 26, 3 dots over 27, 5 dots over 28, 3 dots over 30, 3 dots over 32, 1 dot over 35 Which box plot represents the dot plot data? box plot titled ACT Score with a minimum of 24, quartile 1 of 25, median of 26, quartile 3 of 29, and maximum of 35 box plot titled ACT Score with a minimum of 23, quartile 1 of 25, median of 26, quartile 3 of 29, and maximum of 36 box plot titled ACT Score with a minimum of 23, quartile 1 of 27, median of 30, quartile 3 of 34, and maximum of 36 box plot titled ACT Score with a minimum of 24, quartile 1 of 27, median of 28, quartile 3 of 30, and maximum of 35 Could someone clarrify this for me Factor completely 3x^2 + 2x 1. (3x + 1)(x 1) (3x + 1)(x + 1) (3x 1)(x + 1) (3x 1)(x 1) find the area of square whose side is 2.5 cm How many solutions does the nonlinear system of equations graphed belowhave?y10+-1010-10A. OneB. Two0OC. FourOD. Zero Choose the word showing the correct stress/accent. The syllable written in uppercase letters is the accented syllable. The students (survey) the island where they will conduct their case studies. a. survey b. SURvey c. surVEY d. SURVEY please help! :)As a student who appreciates the importance of the carbon and oxygen cycles, suggest ways to ensure a balance of carbon dioxide and oxygen content in the air. Chris had $4 in cash, with which he purchased coffee for $0.79, a bag of chips for $1.69 and a lottery ticket for $1.00. If he does not have to pay sales tax, how much change should he receive? Find the interest on a Principal Balance of $10,000 over the course of eight years with an interest rate of 5.5%. Do this for: Simple Interest. Budgeted variable overhead for the year is $150,000. Expected activity is 30,000 standard direct labor hours. The actual hours worked were 15,000 and the standard hours allowed for actual production were 18,000. The variable overhead efficiency variance is: 88 feet/second = 60 miles/hour. How many feet per second is 1 mile/hour? (Hint: divide both sides of the equationby the same amount.)Round to the nearest thousandth.One mile per hour is equivalent toao feet/second Write as an inequality. "Four more than half a number is at most sixteen" Determine what type of model best fits the given situation: The height of a tree twenty feet tall increases by 2 feet per year. A students wants to report on the number of movies her friends watch each week. The collected date are below:0, 0, 1, 1, 2, 2, 2, 14which measure of center is most appropriate for this situation and what's its value?A.) Median; 1.5B.) Median; 3C.) Mean; 1.5D.) Mean; 3 Explain 2 ways UDL can be an effective means for addressing the learning needs of both typical and atypical students. Maria had 600 coins in her wallet, but now she has 30 left of coins. What percentage of the 600 money does he have left? A company believes that its product will exhibit network effects if enough consumers begin to use it. How might this company decide to price its product? Offer the product for free early on, and increase the price later.