in the figure below, lines m and n are parallel. What is the value of x?

In The Figure Below, Lines M And N Are Parallel. What Is The Value Of X?

Answers

Answer 1

Answer:

x = 51

Step-by-step explanation:

It looks like alt int. angles (correct me if im wrong)

3x - 40 = 2x + 11

x = 51


Related Questions

ill give brainliest, help me asap!
Lin says she has memorized the lengths of a few right triangles, for example, 3, 4, and 5. She is trying to compile a list of several right triangles but needs your help. Find the side lengths of at least two other right triangles.

Answers

Answer:

6-8-10

9-12-15

5-12-13

Step-by-step explanation:

We know the 3-4-5 right triangles work when you multiply the sides by anything. For example. 6-8-10 and 9-12-15 work.

If you want other right triangles that follow a similar pattern, 5-12-13 is also viable. 10-24-26 & 15-36-39 are all right triangles

The 6, 8, 10, and 9, 12, and 15 are other sides of the right-angle triangle after applying Pythagoras theorem.

What is a right-angle triangle?

It is a triangle in which one of the angles is 90 degrees and the other two are sharp angles. The sides of a right-angled triangle are known as the hypotenuse, perpendicular, and base.

We have:

Lin says she has memorized the lengths of a few right triangles, for example, 3, 4, and 5.

There are 6, 8, 10, 9, 12, and 15 other sides of the right-angle triangle.

On applying Pythagoras theorem.

6² + 8² = 10²

9² + 12² = 15²

Thus, the 6, 8, 10, and 9, 12, and 15 are other sides of the right-angle triangle after applying Pythagoras theorem.

Learn more about the right-angle triangle here:

brainly.com/question/3770177


#SPJ2

Ben earned $ 400 mowing lawns this month. Of his earnings, he plans to spend 18% repairing
lawn equipment, deposit 20% in his savings, and use 35% for clothes. He will spend the rest.
How much will Ben have left to spend Show your work. help ill mark brainlessly

Answers

Answer:

K 110

Step-by-step explanation:

Find the amount to be spent for each item/service

18% of $400= $72

20% of $400= $80

35% of $400= $140

Now, add all his expenditures and subtract it from his income

$400 - ($72+$80+$140) = $400 - $290 = $110

Graph the difference between (4.5, -1.5) and (4.5, 7.25)

Answers

Answer:

The difference is 8.75

Step-by-step explanation:

Plot the points or 7.25+1.5=8.75

What is the factorization of the polynomial below? 3х2 + 30x + 48​

Answers

Answer:

3(x+2)(x+8)

Step-by-step explanation:

Answer:

[tex]3(x+8)(x+2)[/tex]

Step-by-step explanation:

[tex]3x^2 + 30x + 48 = 3(x^2 + 10x+ 16) = 3(x+8)(x+2)[/tex]

A number is selected, at random, from the set 1, 2, 3, 4, 5, 6, 7, 8. Find: p(odd)
25%
50%
100%

Answers

Answer:

50%

Step-by-step explanation:

Half of the numbers in the sequence are odd, so there's a 50% to have gotten an odd number randomly. Therefore, P = 50%

WILL GIVE BRAINLEST

Keisha conducts a survey to determine how many siblings each of her classmates has. The data are shown below.

0, 1, 0, 2, 2, 1, 3, 0, 4, 0, 1, 2

What is the mean value of Keisha’s data?
A. 0.75
B. 1
C. 1.3¯
D. 2

Answers

Answer:

c

Step-by-step explanation:a

add up 0, 1, 0, 2, 2, 1, 3, 0, 4, 0, 1, 2

Answer:

C. 1.3

Step-by-step explanation:

0, 0, 0, 0, 1, 1, 1, 2, 2, 2, 3, 4

To find the mean, or average, we add up all the numbers to get the total number of siblings (16), and divide by the number of classmates she surveyed (12). 16/12 = 1.3

Please LMK if you have questions. Have a good day.

hi can you help me to answer this?​

Answers

Answer:

1) 85

2) 150

Step-by-step explanation:

The measure of a minor arc is EQUAL to the central angle

"The measure of a minor arc is equal to the measure of the central angle that intercepts the arc. We can also say that the measure of a minor arc is equal to the measure of the central angle that is subtended by the arc."

PLZ HELP WILL MARK BRANLIEST (No dum answers or I will delete your question - seriously don't be annoying)
Use the​ (x,y) coordinates in the figure to find the value of tan (2(pi)/3) or state that the expression is undefined.
Select the correct choice below​ and, if​ necessary, fill in the answer box to complete your choice.

Answers

Answer:

A. tan(2π/3) = [tex]-\sqrt{3}[/tex]

Alright fam, help me out here with these angles thanks!

Answers

Answer:

m∠3 = 127°

Step-by-step explanation:

From the given picture,

Two parallel lines have been given.

Angle 3 and another angle measuring 53° are located on a point of a straight line.

Therefore, both the angles will be supplementary.

m(∠3) + 53° = 180° [Property of supplementary angles]

m(∠3) = 180° - 53°

          = 127°

HELPPPP PLEASEEE!!!!!!

Answers

Answer:

24.5

Step-by-step explanation:

please give me brainliest

I can't seem to get this one can someone please help me

Answers

Answer:

The answer should be C

Step-by-step explanation:

Answer

Please help I need to get this done and I am confused

Answers

Answer:

Step-by-step explanati

7,5

6,8

2,4

1,3

what is the distance

Answers

Answer:

A) 10 units

Step-by-step explanation:

distance formula:

d=the square root of (x2-x1)^2 + (y2-y1)^2

(-5,4)

(3,-2)

d=the square root of (3-[-5])^2 + (-2-4)^2

d=the square root of 64+36

d=the square root of 100

d=10

What is the radius of a cylinder with 490picm^3 of volume and 10 cm of height

Answers

V = pi*r^2*h
V = 490
h = 10
490 = pi*r^2*10
r = 3.95

A cube has a volume of 64. What is the side length of one side
#15

Answers

Answer:

4

Step-by-step explanation:

volume is equal to a x a x a

This means that [tex]a^{3}[/tex] = V

Therefore, a = cube root of V, which is 4

It would be 4.

Using the formula
V=a3
Solving fora
a=V⅓=64⅓≈4

Help with 8 pls thanks

Answers

Answer:

m<Y = 68°

Step-by-step explanation:

A tangent drawn to a circle makes a 90° angle with the radius that intersects it at the point of tangency. That means that m<X = 90°.

The sum of the measures of the angles of a triangle is 180°.

m<X + m<Y + m<Z = 180

90 + m<Y + 22 = 180

m<Y + 112 = 180

m<Y = 180 - 112

m<Y = 68

the perimeter of a square piece of confetti is 28 mm. how long is each side of the piece of confetti?​

Answers

Answer:

7 mm

Step-by-step explanation:

A square has 4 equal sides, so the piece of confetti will have 4 sides of the exact same length.

Find the length of each side by dividing the perimeter by 4

28/4

= 7

So, each side of the confetti piece is 7 mm

Which graph represents the table below?
х
-1
0
1
y
4
1
-2

Answers

Huh send a picture of it

Find the mean and the standard deviation of the data set {2, 3, 6, 7, 6}.

Answers

3 is the deviation of the set of data

Which equation has infinitely many solutions?
5(2x + 4) = 10x – 12
5(2x + 4) = 10(x + 2)
5(2x + 4) = 12x
5(2x + 10) = 20(x + 1)

Answers

Answer:

5(2x + 4) = 10(x + 2)

Step-by-step explanation:

answer is 0 so it has infinite solutions

Answer: B. 5(2x+4)=10(x+2)

Explanation: Equals 0 because once distributed both equations are equal.
(A method to help you know without having to solve it.)

Hope this helps!

How would I right subtract 1.9 from the product of 7.4 and 3

Answers

Answer:

24.1

Step-by-step explanation:

7.4x3=22.2

22.2+1.9=24.1

Which countries are
in north America

Answers

Answer:

Canada, Mexico, America

Step-by-step explanation:

Canada is one and Mexico

jane and kate share $240 in the ratio 5:7. show that kate receives $140

Answers

Answer:

$140

Step-by-step explanation:

5 + 7 = 12

240/12 = 20

20 x 7 = $140

Hope this helps!!

King Kyle orders the construction of his future mausoleum (a fancy tomb) so that people never forget his awesomeness. His architect draws a floor plan depicting the mausoleum as a rectangle measuring 35 m 35 m35, start text, space, m, end text by 40 m 40 m40, start text, space, m, end text.

Answers

Answer:

14×16

Step-by-step explanation:

The plan of the mausoleum measures 35 metres (width) by 40 metres. It is 2.5 m per square. When redecorating the grave on the grid, 14 (width) by 16 (height) squares should be counted.

1 + 1 = ? help now please asap!

Answers

Question:

1 + 1 = ? help now please asap!

Answer:

1 + 1 = 2

hope this helps :)

Which equation represents a linear function

Answers

Answer: B

Step-by-step explanation:

Packs of dark chocolate contain 5 cookies, and packs of white chocolate cookies contain 6 cookies. If Daniel bought the same number of cookies of each the, what is the smallest number of each type he could have bought?

Answers

Answer:

30

Step-by-step explanation:

30 because 5 x 6=30 and 6 x 5= 30

25- 3x = 40 what is x

Answers

Simplifying
25 + -3x = 40

Solving
25 + -3x = 40

Solving for variable 'x'.

Move all terms containing x to the left, all other terms to the right.

Add '-25' to each side of the equation.
25 + -25 + -3x = 40 + -25

Combine like terms: 25 + -25 = 0
0 + -3x = 40 + -25
-3x = 40 + -25

Combine like terms: 40 + -25 = 15
-3x = 15

Divide each side by '-3'.
x = -5

Simplifying
x = -5

It cost $730 to put on a school play . How many tickets must be sold at $6 a piece in order to make a profit

Answers

Answer:

122

Step-by-step explanation:

if you do 730 divided by 6 the answer is 121.6666667 so you round it up to 122

A plot of land for sale has a width of x ft, and a length that is 8 ft. less than its width. A farmer will only purchase the land if it measures 240 ft.
a. Create an equation in terms of w that models this situation
b. What is the width? What is the length?​

Answers

Answer:

a

Step-by-step explanation:

Answer:

dunno

Step-by-step explanation:

Other Questions
13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA Arrange the following steps to explain the process of protein synthesis inside the eukaryotic cell. Help please! 50 points! Troll answers WILL be reported Describe how each of thefollowing are evidence for Continental Drift1. Fossils2. Landforms3. Rock Formations4. Climate what is 3/4x2/3a.5/12b. 6/12c.5/7d. 6/7 How to not go to jail for j walking (HELP ASAP)Select the graph which best represents this scenario:The amount of pancake batter that you must mix increaseswith the number of people who come to breakfast. It takes3 cups of batter to serve 10 people.(More context in the picture) What is not a type of text format that will automatically be converted by Outlook into a hyperlink?O email addressO web addressO UNC pathO All will be automatically converted. Cup G has a diameter of 4 in. and a height of 8 in. Find the volume of Cup G. (24^0)+(4^0). solve this problem fast Where dose the earliest known Indian literature come from Eva has a coupon for an oil change with synthetic oil for $59.95. She can buy 5 quarts of synthetic oil, which is what her car needs, for $26.54 and an oil filter for $6.47. How much can she save by doing the oil change herself?$79.22$139.17$59.95$32.92$26.94 which element is shown in the picture here? What is the sum of the two polynomials? Which of the following Spanish words is not a preposition?1. soy2. con3. para 4. de Grapes cost $3.25 per pound. Darius paid a total of $26 for grapes.How many pounds of grapes did Darius buy? Imagine that the economy is in long-run equilibrium. Then, perhaps because of improved international relations and increased confidence in policy makers, people become more optimistic about the future and stay this way for some time.1. Refer to Optimism. Which curve shifts and in which direction? a. aggregate demand shifts right.b. aggregate demand shifts left.c. aggregate supply shifts right. d. aggregate supply shifts left. 2. Refer to Optimism. In the short run what happens to the price level and real GDP? a. both the price level and real GDP rise. b. both the price level and real GDP fall. c. the price level rises and real GDP falls. c. the price level falls and real GDP rises. 3. Refer to Optimism. What happens to the expected price level and what's the result for wage bargaining? A. The expected price level falls. Bargains are struck for higher wages. B. The expected price level rises. Bargains are struck for higher wages. C. The expected price level rises. Bargains are struck for lower wages. D. The expected price level falls. Bargains are struck for lower wages.4. Refer to Optimism. In the long run, the change in price expectations created by optimism shifts:_____.a. long-run aggregate supply right. b. long-run aggregate supply left. c. short-run aggregate supply right. d. short-run aggregate supply left. 5. Refer to Optimism. How is the new long-run equilibrium different from the original one? a. both price and real GDP are higher.b. both price and real GDP are lower. c. the price level is the same and GDP is higher. d. the price level is higher and real GDP is the same. 6. People choose to hold a smaller quantity of money if:_____.a. the interest rate rises, which causes the opportunity cost of holding money to rise.b. the interest rate falls, which causes the opportunity cost of holding money to rise.c. the interest rate rises, which causes the opportunity cost of holding money to fall.d. the interest rate falls, which causes the opportunity cost of holding money to fall. 7. When the Fed sells government bonds, the reserves of the banking system:___.a. increase, so the money supply increases. b. increase, so the money supply decreases. c. decrease, so the money supply increases. d. decrease, so the money supply decreases. Which time interval has the greatest speed? resulve las siguientes operaciones matematicas en tu cuadernk PLEASE HELP! Please help me I dont understand how to do this and it has to be done by tonight!!!