If the food on the island is small seeds, what finch is best adapted? Explain why

Answers

Answer 1

Answer:Adaptation in Darwins Finches. Beak depth, which is correlated with body size and the ability to crack larger seeds, varies according to drought conditions: plants produce fewer, harder seeds in dry years and more, softer seeds in wet years. Only larger birds with deeper depths survive in drought years.

Explanation:


Related Questions

The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.

What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?

An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.

Answers

The question to the above information is;

What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?

Answer;

An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.

Explanation;

-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.

J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:

atoms are spheres of positive chargeelectrons are dotted around inside

Answer:

Its C on edge

Explanation:

write a short paragraph on hydra​

Answers

Answer:

at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)

Explanation:

Hydra are simple invertebrates, with two layers of body cells. They live in fresh water. Their body is radially symmetric. They have a central cavity through which they take in food and expel waste.

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

A) Group X = Rose ,mango tree,marigold,palm tree

B) This is the answer of group X =Rose ,mango

This is the answer of group Y =Fern ,pine trees

Explanation:

Answer:

jen, from my heart im saying i lu.v u for real

its been almost 5 months weren't having the same old c.hat we used to have.

ik that ur scared to c.hat with  me since the day ur mom caught u

but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u

and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could

i'll be waiting for that moment and i hope u would be too...

still lu.v u :(  .......

o
1. Which criteria are used to classify amphibians into orders?

Answers

Answer:

They are classified into three orders: frogs and toads, salamanders and newts, and caecilians.

Approximately 8,100 species of living amphibians are known. First appearing about 340 million years ago during the Middle Mississippian Epoch, they were one of the earliest groups to diverge from ancestral fish-tetrapod stock during the evolution of animals from strictly aquatic forms to terrestrial types. Today amphibians are represented by frogs and toads (order Anura), newts and salamanders (order Caudata), and caecilians (order Gymnophiona). These three orders of living amphibians are thought to derive from a single radiation of ancient amphibians, and although strikingly different in body form, they are probably the closest relatives to one another.

1. Energy transfer is inefficient between trophic levels because

A. Molecules are fully digested from each trophic level.

B. Dead organisms and waste are recycled throughout the trophic levels.

C. Organisms within a trophic level are fully consumed.

D. All organisms within a trophic level die.

2. Primary productivity is defined as

A. The rate that plants and other photosynthesis organisms produce organic compounds.

B. The process where green plants and some other organisms convert light energy into chemical energy using carbon dioxide and water.

C. The overall amount of energy captured by plants and other photosynthetic organisms by the chloroplast.

D. The adjusted amount of energy in an ecosystem due to energy use by organisms for respiration.

Thanks if you help, It's highly appreciated. :-)​

Answers

Answer: b dead organisms And waste are recycled throughout the tropic levels.

Explanation:

Answer:

part 2

the rate that plants and other photosynthetic organisms produce organic compounds.

Explanation:

:)

Which of these is an advantage of fossil fuels? *

O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable





Answers

Answer:

reliable

Explanation:

Explanation:

Fossil fuels are a non-renewable resource.

What increases as you move from the surface to the interior of the Earth?

Answers

Answer:

Heat/temperature

Explanation:

"There are three main sources of heat in the deep earth: (1) heat from when the planet formed and accreted, which has not yet been lost; (2) frictional heating, caused by denser core material sinking to the center of the planet; and (3) heat from the decay of radioactive elements." These give the core and a few of the outer layers of the earth more and more heat.

Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.

Answers

Answer:

The answer is B

B. They are both made of subatomic particles.

Which factor makes enzymes well-suited to the role of catalyst in a biochemical reaction?

A)Enzymes do not affect the energy of a reaction.

B)Enzymes slow down reactions so products can form.

C)Enzymes can be reused because they do not permanently bond with substrate.

D)Enzymes can only bind to other enzymes so the same product is formed each time.

Answers

Answer: C

Explanation: Once an enzyme binds to a substrate and catalyzes the reaction, the enzyme is released, unchanged, and can be used for another reaction.

Enzymes can be reused because they do not permanently bond with substrate.

What are Enzymes?

A biological catalyst called an enzyme is usually always a protein. It accelerates a certain chemical reaction in the cell. The enzyme is continuously employed during the reaction and is not destroyed. Each enzyme molecule found in a cell is unique and tailored to a particular chemical reaction.

Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial.

Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.

Therefore, Enzymes can be reused because they do not permanently bond with substrate.

To learn more about Enzyme, refer to the link:

https://brainly.com/question/14953274

#SPJ6

PLEASE HELPPPPPPP

(Monstro the Goldfish & Epigenetics)

Answers

Answer:

mmmmmmmmmmmmdddddd

Explanation:

ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd

Can someone please help me

Answers

Answer:

carbon dioxide plus water in the presence of light energy to sugar and oxygen

There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles​

Answers

Answer:

nucleus

Explanation:

chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.

The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.

What are eukaryotic cells?

Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.

There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.

The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.

Thus, the correct option is C. nucleus.

To learn more about eukaryotic cells, refer to the link:

https://brainly.com/question/982048

#SPJ6

Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP

A. Transport from complex I produces more ATP.

B. Transport from complex II produces more ATP.

C. Both produce the same amount of ATP.

Answers

Answer:

A

Explanation:

ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.

Electron transport from complex I produces more ATP.

ELECTRON TRANSPORT CHAIN:

The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration.

The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis.

The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers.

Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space.

Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.

Learn more: https://brainly.com/question/442662?referrer=searchResults

Which of the following foods are native to rainforests?
a. papayas
b. mangoes
c. Sugarcane
d. all of the above

Answers

Answer:

on edge here's the correct answer

Explanation:

Answer: It is D)

Explanation:

Which objects have the most eccentric orbits?
A. Uranus and Neptune
B. Jupiter and Earth
C Saturn and Venus
D. Mercury and Pluto

Answers

Pluto and mercury is the correct answer

help need answer asap !!

Answers

Wet is irrigation Forest is paper preserving aesthetic value is park trapping sediments as water

Which statement best explains the myth about how Romulus and Remus founded Rome?

Answers

After deciding to build a town on one of seven hills, Romulus and Remus had to decide which hill to base it off of and Romulus chose Palatine hill and Remus chose Aventine Hill, Later leaving Romulus to kill Remus in a fight and build the city on Palatine hill hence the name Rome.

Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.

Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer

An example of __ is the color of betta fish. When a RED fish (GG) is crossed with a YELLOW fish (gg), all of the offspring will be a ORANGE color (Gg)

Answers

Answer:

The correct answer is  - incomplete dominance.

Explanation:

In the betta fish, there are different types of colors found in the fishes depends on the alleles present in their gene which follows incomplete dominance. Incomplete dominance is an inheritance pattern where a dominant allele does not mask completely and produce a blend of both alleles if present in heterozygous condition.

In the question, It is stated that when a cross between RED fish (GG) and a YELLOW fish (gg) produce orange color fish as offspring (Gg) which is a mix or blend of both alleles Red (dominant) and yellow (recessive).

What is the purpose of the other tube of water?

Answers

Explanation:

cant see photo

Answer:

delude the other thing

there is no picture so i have no idea what your asking. ill edit this answer to be more specific when you explain

Explanation:

What is the atomic mass of Sulfur that has 18 neutrons?

Answers

Answer:  32.066 atomic mass units

B is the correct option.

17. What causes evaporation?
O Air that is unsaturated with water vapor comes into contact with the surface of the water
O Air that is cooler than the water comes into contact with the surface of the water
O Air that is warmer than water comes into contact with the surface of the water
O Air that is supersaturated with water vapor comes into contact with the surface of the water in

Answers

the answer is the first one

Evaporation occurs when air that is warmer than water comes into contact with the water's surface, hence option A is correct.

What is evaporation?

As a liquid transforms into a gas, evaporation, a sort of vaporization, occurs on the liquid's surface. For instance, a high concentration of the evaporating substance in the surrounding gas significantly slows down evaporation when humidity affects the rate of evaporation of water.

It takes in moisture from garden soil as well as the biggest lakes and seas, and the level of the water will decrease when it is heated by the sun.

Therefore, solar energy, or heat from the sun, is what causes the evaporation process to occur, hence option A is correct.

Learn more about evaporation, here:

https://brainly.com/question/5019199

#SPJ5

How does evolution result in reproductive success?

Answers

Answer:

Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.

HURRY. Why is transcription said to be unidirectional?

Answers

Answer:

Transcription is unidirectional because you are copying only ONE side of the DNA. Remember that DNA is a double stranded helical structure. One strand of DNA is complementary to the other strand.

Explanation:

Can you tell me which go where?

Answers

Answer:

heredity goes to the first one

phenotype at the second one

Explanation:

Most stars seem to move across the night sky because
a. the universe is expanding
b.the universe is getting smaller
c. Earth is orbiting the Sun
d. Earth is spinning on its axis

Answers

I think it is C but uh if its not D Hope this helps-

Explanation: because

20 points and will mark brainliest! Please explain how you got it though

Answers

Answer:

crossing over during meiosis

Explanation:

i just had biology last semester hope this helps

please answer this!!

Answers

Answer:

mouth coughing out biok sid carbon

How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?

Answers

Answer:

Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

What change to the following molecule's structure would result in a saturated fat?

Answers

Answer:

It needs to gain a Hydrogen atom to eliminate the double bond between the two carbons.  

Explanation:

Unsaturated fat has one or more double bonds in its molecule. Saturated fat has a single bond. If you want an unsaturated fat to become saturated it needs to gain more more hydrogen atoms which will eliminate the double bonds between carbons of the unsaturated fat.

Hope this helped :)  

Other Questions
Which equation produces the values in the table?O y= 4xO y=4+xO y=1/4xOy=4 - x help this is 7th grade mth The meaning of an inequality depends on the __________________of the inequality sign. When looking at security standard and compliance, which three (3) are characteristics of best practices, baselines and frameworks A pet shop offers an iguana for $\color[rgb]{0.35,0.35,0.35}\$80$ and a parakeet for $\color[rgb]{0.35,0.35,0.35}\$40$. During a sale, Chris bought the iguana at a $\color[rgb]{0.35,0.35,0.35}40\%$ discount and the parakeet at a $\color[rgb]{0.35,0.35,0.35}55\%$ discount. The total amount saved on Chriss new pets was what percent of the total of their original prices? what is responsible for cultural divergence in europe? Please Help, It is not F. The first answer choiceThank you very much what are 2 consequences of the Coercive Acts A line has a slope of a and has a y-intercept of (0,b). Which equation represents this line? A. y-b=a(x-0) B. y+b=a(x-0) C. y-0=a(x-b) D. y-0=a(x+b)PLEASE HELP GIVING 50 POINTS!!! Question 1Find the missing angle to the nearest degree.3614degrees What are the Ten Commandments? Why are the Ten Commandments importantto the Hebrews? Whats three types of group discussions Find the solution to the system of equations: x + 3y = 7 and 2x + 4y = 81. Isolate x in the first equation:2. Substitute the value for x into the second equation:3. Solve for y:4. Substitute y into either original equation:5. Write the solution as an ordered pair:x = 7 3y2(7 3y) + 4y = 814 6y + 4y = 814 2y = 82y = 6y = 3x + 3(3) = 7(, ) Complete the sentence using the bare infinitive. 1.My parents often make me __________ English Subject Second-person point of view features the narrator speaking directly to the reader. the use of the pronouns I, me, and my. the use of the pronouns he, she, and they. the thoughts and feeling of all the characters. On any given day or night, what determines the visible phase of the moonA. how much of the sunlit side of the moon is visibleB. the time of day or night that we look at the moonC. how far the moon has rotated on its axisD. how much of the moon is lit by the sun if a car travels 120 miles in 4 hours. what is its speed per hour The black graph is the graph of y=f(x). Choose the equation for the red graph. QR is parallel to ST Rs is parallel TU QS is congruent to SUprove QRS is congruent to STU how many elements does lythium have