If f(x)= Square root of X +12 and g(x)= 2 Square root of X what is the value of (f-g)(144)

Answers

Answer 1

Answer:

0

Step-by-step explanation:


Related Questions

PLS HELP BRAINLIST AND A THANK YOU WILL BE REWARDED

Answers

Answer:

x=25

Step-by-step explanation:

you know that both angles equal the same degrees, so the bottom one is 150° so the other is also 150°. You already have 50° so all you need left is 100°. divide 100 by 4 and you get x=25

You weigh six packages and find the weights to be 28, 22, 52, 25, 49, and 46 ounces. If you include a package that weighs 142 ounces, which will increase more, the median or the mean?

Answers

Answer:

Step-by-step explanation:

Original Median (28+46)/2 = 37

Original Mean (222/6) = 37

New Median (46)

New Mean (52)

Mean increases the most.

The mean will increase more.

We have weights of six packages  28, 22, 52, 25, 49, and 46.

We have to find if we include a package that weighs 142 ounces, which will increase more, the median or the mean.

What is the formula to find the Median of a set of odd number of elements (say N) ?

If a set consist of odd number of elements, then the median of that set of numbers is the is the element at the position [tex]\frac{(N+1) }{2}[/tex].

If we don't include the package of 142 ounce, then -

Mean = [tex]\frac{28 + 22 + 52 + 25 + 49 + 46}{6} = 37[/tex]

Median = [tex]\frac{52 + 25}{2} = 38.5[/tex]

After including the package of 142 ounce,

Mean = [tex]\frac{28 + 22 + 52 + 25 + 49 + 46+142}{6} = 52\\[/tex]

Median = Element at [tex]\frac{(N+1) }{2}[/tex] position = 25

Hence, mean increase more.

To solve more questions on mean and median, visit the link below -

https://brainly.com/question/9820885

#SPJ2

please answer the question ​

Answers

Answer is C

Step-by-step explanation:

I assure you that if you check a,b,c, and d by putting them into desmos graphing calculator you can find which graph it is. I plugged the third equation in and found that they were exact. If you want to do it the "smart" way that I teacher would show you, as you look at the answers and determine by certain points on the graph which one lines up. You start with 1/x.

Good Luck


A.) 170
B.) 300
C.)280
D.)155
Please help me

Answers

Answer:

Step-by-step explanation:

The formula for this is

∠G = 1/2(arcEH - arcHF)

We have angle G (5x - 10) and we have arcEH (195) so we have to solve for x to find the measure of arcEHF so we can add arcEH + arcHF = arcEHF

Filling in the formula with what we have:

[tex]5x-10=\frac{1}{2}(195-(8x+17))[/tex]

which simplifies down a bit to

[tex]5x-10=\frac{1}{2}(195-8x-17)[/tex] which simplifies down a bit more to

[tex]5x-10=\frac{1}{2}(178-8x)[/tex] Multiply both sides by 2 to get rid of the fraction and get:

2(5x - 10) = 178 - 8x which of course simplifies to

10x - 20 = 178 - 8x. Now add 8x to both sides and at the same time add 20 to both sides to get:

18x = 198 so

x = 11. Now we can find the measure of arcHF:

arcHF is 8x + 17, so arcHF is 8(11) + 17 which is 105°.

arcEH + arcHF = arcEHF so

195 + 105 = arcEHF so

arcEHF = 300°

Maria has eight black marbles, fourteen clear marbles, and twelve blue marbles in a bag. If she picks two marbles at random, without replacement, what is the probability that she will select a blue marble first, then a clear marble?

Answers

Answer:

[tex]\boxed{0.15}[/tex]

Step-by-step explanation:

Part 1: Solve for the total amount of marbles

To solve for the probability of certain events, a population is needed to derive this information from. In order to find this population, add up the amounts of each marble.

8 + 14 + 12 = 34 marbles

Part 2: Determine the probabilities

Now, given the amounts of marbles, simply multiply the ratios of blue marbles to total marbles and the ratio of clear marbles to total marbles to get the combined probability.

[tex]\frac{12}{34}*\frac{14}{33} = \frac{28}{187} \approxeq 0.1497 \approxeq 0.15 * 100 = 15[/tex]

The probability of these events occurring simultaneously is 15%.

does it matter in what order we divide our our prime factors explain

Answers

Answer:

No, it does not matter.

Step-by-step explanation:

In prime factorization there is only one way to be factored. Once these numbers are broken down, into prime numbers you will get the same result no matter what list of prime numbers you use and what order you use them in.

△ABCis reflected to form​​ ​△A′B′C′​. The vertices of △ABC are A(-1, 3), B(2, 4), and C(-5, 6). The vertices of △A′B′C′ are A′(3, −1), B′(4, 2), and C′(6, −5). Which reflection results in the transformation of ​△ABC​​ to ​△A′B′C′​​? Reflection across the x-axis reflection across the y-axis reflection across y = x reflection across y=−x

Answers

Answer:

reflection across y = x

Step-by-step explanation:

Transformation is the movement of a point from its initial position to a new position. If a shape is transformed, all its point are also transformed. Types of transformation is reflection, rotation, transformation and dilation.

If a point is reflected across the x axis, the x coordinate is the same but the y coordinates is negated. If X(x, y) is reflected across the x axis the new point is X'(x, -y)

If a point is reflected across the y axis, the y coordinate is the same but the x coordinates is negated. If X(x, y) is reflected across the y axis the new point is X'(-x, y)

If a point is reflected across y = x, the x coordinate and y coordinates are interchanged. If X(x, y) is reflected across the y=x axis the new point is X'(y, x)

If a point is reflected across y = -x, the x coordinate and y coordinates are interchanged and both negated. If X(x, y) is reflected across the y=ix axis the new point is X'(-y, -x)

The vertices of △ABC are A(-1, 3), B(2, 4), and C(-5, 6). The vertices of △A′B′C′ are A′(3, −1), B′(4, 2), and C′(6, −5). The reflection of △ABC to form​​ ​△A′B′C′ shows a reflection across x axis since the x and y coordinates are interchanged

Answer:

reflection across y = x

Step-by-step explanation:

Given the function f(x) = x + 7 What would the input have to be so that f(x) = 15?
I really need help with question.

Answers

Step-by-step explanation:

[tex]\huge{\purple{\underline{\underline{\bf{\pink{Answer}}}}}}[/tex]

in this we have given the value of f(x) = 15

[tex]f(x) = x + 7[/tex]

[tex]f(15) = 15 + 7[/tex]

[tex]f(15) = 22[/tex]

so this is ur answer

hope it helps .

Determine the most precise name for KIET (parallelogram,rhombus,rectangle or square.) you must use slope or length. K(0,0) I(2,2) T(5,-5) E(7,-3)

Answers

Answer: rectangle.

Step-by-step explanation:

Given points: K(0,0) I(2,2) T(5,-5) E(7,-3)

Distance formula to find distance between [tex]A(a,b)[/tex] and [tex]B(c,d)[/tex]: [tex]AB=\sqrt{(d-b)^2+((c-a)^2}[/tex]

[tex]KI=\sqrt{(2-0)^2+(2-0)^2}=\sqrt{4+4}=\sqrt{8}=2\sqrt{2}\ units[/tex]

[tex]KT=\sqrt{(5-0)^2+(-5-0)^2}=\sqrt{25+25}=\sqrt{50}=5\sqrt{2}\ units[/tex]

[tex]TE=\sqrt{(7-5)^2+(-3+5)^2}=\sqrt{4+4}=\sqrt{8}=2\sqrt{2}\ units[/tex]

[tex]IE=\sqrt{(7-2)^2+(-3-2)^2}=\sqrt{25+25}=\sqrt{50}=5\sqrt{2}\ units[/tex]

i.e. KI = TE and KT= IE, so opposite sides equal.

It can be a parallelogram or rectangle. [if all sides are equal it would be square or rhombus]

[tex]IT=\sqrt{(5-2)^2+(-5-2)^2}=\sqrt{3^2+7^2}=\sqrt{9+49}=\sqrt{58}\ units[/tex]

[tex]KE=\sqrt{(7-0)^2+(-3-0)^2}=\sqrt{7^2+3^2}=\sqrt{9+49}=\sqrt{58}\ units[/tex]

IT= KE, i.e. diagonals are equal.

It means KIET is  a rectangle.

PLS HELP!! Consider the exponential functions f, g, and h, defined as shown. Determine which function or functions have each key feature. Drag the tiles to the correct boxes. Not all tiles will be used.

Answers

Answer:

1) increases on all interval of x = only g(x)

2) approaches an integer as x approaches -∞ = only f(x)

3) y-intercept at (0, 4) = only g(x)

4) x-intercept at (1, 0) = f(x) and h(x)

Step-by-step explanation:

1) The functions that increases on all interval of x are;

f(x) = -2(3)ˣ + 6 decreases on all interval of x

The function g(x) which is 4 × 4ˣ  increases on all interval of x

The function h(x) is observed to be decreasing as x increases, therefore, the only function that increases on all interval of x = g(x)

2) The function that approaches an integer as x approaches -∞ = -2(3)ˣ + 6

-2(3)ˣ + 6 approaches 6 as x approaches -∞ which is only f(x)

3) The functions that have a y-intercept at (0, 4) is only g(x)

4) The function that have a x-intercept at (1, 0) are f(x) and h(x).

Answer:

A) f(x) and g(x)

B) only g(x)

C) All three functions

D) f(x) and h(x)

Step-by-step explanation:

In my uploaded image on the test I have gotten C) wrong but if you graph all three functions, you can see that all three functions have the same style of -∞

end behavior so I think that would be the most logical answer.

Which matrix represents the system of equations shown below?
3x-2y = 4
6x- y = 10

Answers

Answer:

B.

Step-by-step explanation:

First equation: the coefficients of x and y are 3 and -2, and the constant is 4.

So the first row should be [3 -2 4].

Second equation: the coefficients of x and y are 6 and -1, and the constant is 10. Hence, the second row should be [6 -1 10].

Simplify.
3^2+ (9-8/2)

Answers

Hi there! Hopefully this helps!

-----------------------------------------------------------------------------------------------------------

Answer: 14.

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

First we calculate 3 to the power of 2 and get 9.

|

\/

9 + 9 - [tex]\frac{8}{2}[/tex] = 14.

Now we add 9 + 9 to get 18.

18 - [tex]\frac{8}{2}[/tex] = 14.

Then, we divide 8 by 2 to get 4.

18 - 4 = 14.

Then we subtract 4 from 18 to get.....You guessed it, 14!

Answer: 14

PEMDAS

P: Parentheses

E: Exponets

M: Multiplcaction

D: Divison

A: Addition

S: Subtraction

PEMDAS can also be known as Please Excuse My Dear Aunt Sally

P: [tex](9-8/2)[/tex]

E: [tex]3^2[/tex]

M: [tex]3*3[/tex]

D: [tex]8/2[/tex]

A: [tex]9+5[/tex]

S: [tex]9-8/2[/tex]

Multiply

E: [tex]3^2=3*3=9[/tex]

M: [tex]3*3=9[/tex]

Divide

D: [tex]8/2=4[/tex]

Subtract

S: [tex]9-4=5[/tex]

Add

A: [tex]9+5=14[/tex]

Answer: [tex]14[/tex]

The reason why we didn't use P to get our answer because it would of messed up the steps. So instead we separated it by dividing 8/2 in D and 9-4-5 for S.

Can someone help me with this please it’s algebra 2

Answers

Answer:

7 8 9

Step-by-step explanation:

explain how the phrase oh heck another hour of algebra can help a student recall the trigonometric ratios​

Answers

Answer:

its a mnemonic

Oh  Heck  Another  Hour Of  Algebra

(O = opposite side, H = hypotenuse ) = sine

(A = adjacent side,  H = hypotenuse ) = cosine

(O = opposite side,  A = adjacent ) = tangent

What is negative 14 minus 5

Answers

Answer:

-19

Step-by-step explanation:

(-14)

-5

-------

14+5=19

add the negative

-19

The cost of a daily rental car is as follows: The initial fee is $59.99 for the car, and it costs $0.30 per mile. If Joan's bill was $200.00 before taxes, how many miles did she drive? Please help!

Answers

Answer:

466.7 or 42.003 miles

Step-by-step explanation:

subtract 59.99 from 200.00. Then you have 140.01 and divide or multiply it by 0.30.

12) Express in standard form :
a) 0.000000056 b) 56780000000 c) 1923.8
13) The diameter of a plant cell is 1.26 m and the length of a bacterium is 5.1 m. Compare their
diameters.

Answers

Answer:

part a)

Step-by-step explanation:

What is the volume of the following prism?
7 m
3
Š
6 m

Answers

Answer:

v = 63

Step-by-step explanation:

v = 1/2(7)(6)(3)

v = 63

is 1+isqrt3 a complex number

Answers

Answer:

Step-by-step explanation:

Yes, due to the presence of that operator " i "

Complete the following two-way frequency table.

Answers

Answer:

Step-by-step explanation:

Number of candies with Forest = 12

Candies containing coconut and chocolate both = Number common in coconut and the chocolate = 3

Candies which do not contain coconut but contain the chocolate = 6

Candies which contain the coconut but do not contain the chocolate = 1

Candies which neither contain the chocolate nor coconut = 2

From the given Venn diagram,

                                                Contain coconut         Do not contain coconut

Contain chocolate                              3                                       6

Do not contain chocolate                 1                                        2

What is the asymptote of the function g(x) = 5⋅2^ 3x + 4 shown on the graph?

Answers

Answer:

y=4

Step-by-step explanation:

An exponential function of the form  has a horizontal asymptote of .

The given function is .

The graph of the given function is shown in the attachment.

From the graph the horizontal asymptote is

Pls Answer A and B. You don’t need to explain. Thank you!!

Answers

Answer:
a). Amount of money in Kareem’s acc:
650 - 40x
Amount of money in Karen’s acc:
850 - 65x

b). 650 - 40(8) = 850 - 65(8)

One leg of a right triangle measures 8 units and the hypotenuse measures 12 units. The perimeter of the triangle is irrational. True False

Answers

Answer:

TRUE

Step-by-step explanation:

Length of other leg [tex]= \sqrt {12^2 - 8^2} \\

= \sqrt {144 -64} \\

= \sqrt {80} \\

= 4\sqrt {5} \\[/tex]

Since, [tex] \sqrt 5[/tex] is an irrational number, hence Perimeter of triangle will also be irrational.

TRUE

Answer:

True.

Step-by-step explanation:

The length of the other side = sqrt ( 12^2 - 8^2)

= sqrt (144 - 64)

= sqrt ( 80) which is irrational so the perimeter is also irrational.

(The sum of a rational number and an irrational is irrational).

The city plans a roadway to have trees every mile. If the path is miles long, how many trees will the city need?


30 trees

31 trees

32 trees

33 trees

Answers

Answer:

32

Step-by-step explanation:

the country would need 30 to 33 trees

simplify 5 x 5^2 in index form

Answers

Answer:

5x(25)

Step-by-step explanation:

Please answer it now

Answers

Answer:

8

Step-by-step explanation:

x+37+x+37+90 = 180

2x + 74 = 90

2x = 16

x = 8

Answer:

x=8°

Step-by-step explanation:

JI is a diameter and K is on the circumference of a circle.

∴∠JKI=90°

also KJ=KI=x(say)

tan (x+37)=y/y=1=tan 45

so x+37=45

x=45-37=8°

6 points are place on the line a, 4 points are placed on the line b. How many triangles is it possible to form such that their verticies will be the given points, if a ∥b?

Answers

Answer: 96

Step-by-step explanation:

Ok, lines a and b are parallel.

We can separate this problem in two cases:

Case 1: 2 vertex in line a, and one vertex in line b.

Here we use the relation:

"In a group of N elements, the total combinations of sets of K elements is given by"

[tex]C = \frac{N!}{(N - K)!*K!}[/tex]

Here, the total number of points in the line is N, and K is the ones that we select to make the vertices of the triangle.

Then if we have two vertices in line a, we have:

N = 6, K = 2

[tex]C = \frac{6!}{4!*2!} = \frac{6*5}{2} = 3*5 = 15[/tex]

And the other vertex can be on any of the four points on the line b, so the total number of triangles is:

C = 15*4 = 60.

But we still have the case 2, where we have 2 vertices on line b, and one on line a.

First, the combination for the two vertices in line b is:

We use N = 4 and K = 2.

[tex]C = \frac{4!}{2!*2!} = \frac{4*3}{2} = 6[/tex]

And the other vertice of the triangle can be on any of the 6 points in line a, so the total number of triangles that we can make in this case is:

C = 6*6 = 36

Then, putting together the two cases, we have a total of:

60 + 36 = 96 different triangles

Solve for g.
-3+5+ 6g = 11 – 3g
g =​

Answers

Answer:

g = 1

Step-by-step explanation:

-3 + 5 + 6g = 11 - 3g

Move the variables to one side and the numbers to the other:

9g = 9

Simplify:

g = 1

Answer:

g=1

Step-by-step explanation:

-3+5=2

2+6g=8

11-3g=8

makes sense that g will have to be 1

when symplified 9a-6b+a-b​

Answers

Answer:

10a -7b

Step-by-step explanation:

9a-6b+a-b​

Combine like terms

9a+a   -6b-b

10a -7b

Answer:

10a-7b

Step-by-step explanation:

[tex]9a - 6b + a - b \\ 9a + a - 6b - b \\ 10a - 7b[/tex]

Simplify the following: (74) (6/4)

Answers

Answer:

111

Step-by-step explanation:

Reducing the given expression:

74(6)       37(6)           111

--------- =  ----------  =  ---------- = 111

   4              2                1

Answer:

[tex] \boxed{111}[/tex]

Step-by-step explanation:

[tex] \mathsf{(74) \times ( \frac{6}{4} )}[/tex]

To multiply one fraction by another, multiply the numerators for the numerator and multiply the denominators for its denominator and reduce the fraction obtained after multiplication into lowest term.

⇒[tex] \mathsf{ \frac{74 \times 6}{4 \times 1} }[/tex]

⇒[tex] \mathsf{ \frac{444}{4} }[/tex]

⇒[tex] \mathsf{111}[/tex]

[tex] \mathrm{Hope \: I \: helped !} [/tex]

[tex] \mathrm{Best \: regards !}[/tex]

Other Questions
Maurer, Inc., has an odd dividend policy. The company has just paid a dividend of $2 per share and has announced that it will increase the dividend by $6 per share for each of the next five years, and then never pay another dividend. If you require a return of 12 percent on the companys stock, how much will you pay for a share today HELP ME!!!!And I mark as BRAINLIESTmake sure show proper working Anyone the answers? Please help Last Sunday, the average temperature was 8\%8%8, percent higher than the average temperature two Sundays ago. The average temperature two Sundays ago was TTT degrees Celsius. Which of the following expressions could represent the average temperature last Sunday? Find an equation of the plane through the point(1, 5,-1) and perpendicular to the vector (1, 5, 1). Do this problem in the standard way. Solve for x: 2(10-2x) = 4(3x + 1). Write your answer as a fraction. can u help me ASAP. i need to know how to do it step by step the formula s= I dont know how to type that but I really need helppppp Pasteur's experiments proved that ________. Pasteur's experiments proved that ________. spontaneous generation can only occur if nutrient broth is left open to the environment cells cannot survive in swan-necked flasks preexisting cells present in the air can grow in sterilized nutrient broth sterilizing nutrient broth prevents spontaneous generation in order to grow, cells need to be supplied with oxygen please help !!!!! please note that two images are there................ i am urgently needs this question On a plane trip, baggage over 40 pounds ischarged at the rate per pound of 1% of the one-way fare. The charge for a bag weighing 52pounds on a trip where the one-way fare is $98is:HELP PLEASEE!! QUICK!! When the hydraulic conductivity Ks = 10 mm/hr; effective matrix potential Ns = 20 mm, and rainfall intensity I = 30 mm/hr , determine the amount of runoff generated when the runoff rate reaches 15 mm/hr?( 2.7 mm or 0.21 mm or 18 mm or 0.67 mm) PLS HELP ASAP Solve the inequality and enter your solution as an inequality in the box below 8>4-x>6 difference between photosynthesis and respiration In a survey of adults in a certain country conducted during a period of economic uncertainty, % thought that wages paid to workers in industry were too low. The margin of error was percentage points with % confidence. For parts (a) through (d) below, which represent a reasonable interpretation of the survey results? For those that are not reasonable, explain the flaw. how many are 2 raised to 2 ??? Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCCAACCTAGGTAAGCGCCGAATATCCATGGGCACC 3'3' AGCTAAGGCCTTTCGAATCAAAGGGCCCTGCATAACGGTTGGATCCATTCGCGGCATTATAGGTACCCGTGG 5'a. 5- AGCTAAGGCCTTTCGA and 5'-CCACGGGTACCTATAA b. 5'- TCGATTCCGGAAAGCT and 5'-ACGTCCCGGGAAACTA c. 5- TCGATTCCGGAAAGCT and 5'-CCACGGGTACCTATAA d. 5'- TCGATTCCGGAAAGCT and 5'- GGTGCCCATGGATATT e. 5' - GGTGCCCATGGATATT and 5' ACCTAGGTAAGCGCCG This rectangular patio is tiled using 50 cm by 50 cm square tiles. How many tiles are used? Imagine that you are the supply chain manager for the Magic Widget company and you need to measure your supply chain performance. The chart shows the financial variables that you will need to perform your task. Financial Variables Total Assets (in $ billions) 15.1 Cost of Goods Sold (in $ billions) 14.3 Inventory: Raw Material Inventory (in $ billions) 0.76 Work-in-progress Inventory (in $ billions) 0.12 Finished Goods Inventory (in $ billions) 0.82 Compute the percentage of assets committed to inventory and inventory turnover. What is the quotient of 35,423 15?