If fish are eaten by other organisms would the population increase in size, decrease, or stay the same

Answers

Answer 1
I believe the population would increase over time

Related Questions

If a son has a sex-linked disorder, he received it from ______.

Answers

Answer:

tuff

Explanation:

if the son has a sex-linked disorder, the son received it from his mother

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

Earth science question. Please help

Answers

Answer:

answer choice 4, more rain and a steeper slope cause it to flow faster

Explanation:

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

The soil has certain microbes that interact with the roots of plants in a symbiotic relationship. Which organism is harmed from this relationship?

Answers

Answer:

No organisms

Explanation:

This is because the kind of symbiotic relationship between plants root and microbes is mutualism. In this relationship both organism s benefit and non is harmed. The microbes make nutrients available for the root, it increase root permeability and also root metabolism while the roots provide home for the microbes and Al's derives food.

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

30. Which of the following best explains why enzymes are necessary for many cellular reactions?
A. Enzymes supply the oxygen necessary for the reactions.
B. Enzymes change reactants from solid to liquids during the reactions.
C. The reactions take up too much space in the cell if the enzymes are missing.
D. The reactions are too slow to meet the needs of the cell if enzymes are missing.

Answers

Answer:

D. The reaction are too slow to meet the needs of the cell if enzymes are missing

hope it helps

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars

Answers

Answer:

b

Explanation:

Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.

The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.  

Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:

DNA is the genetic material of the cell  DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formation  

Thus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.  

Learn more about DNA here:

https://brainly.com/question/264225

Substance A is a gas and substance B is a liquid, They are at the same temperature why is one gas and one a liquid

Answers

Difference in boil points between both substances

Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think about
their life cycles. Compare and contrast the life cycles of the four. How do they differ?
es )

Answers

Answer:

Please where's the image of the question

Answer:

B

Explanation:

Both the animal and the plant exhibit stages of growth during their lifetimes. They have what mightbe described as a mature stage. The other two, protist and bacteria do not.

When identifying the agent responsible for causing a disease, why is evaluation of colony morphology not enough?

Answers

Answer:

Some infectious diseases are distinctive enough to be identified clinically. ... Infections may be caused by bacteria, viruses, fungi, and parasites. ... Microbial Identification: Colony and cellular morphology may permit preliminary ... Diagnostic medical microbiology is the discipline that identifies etiologic agents of disease.

Explanation:

Microorganisms have antigens present on their surface, Antigen tests detect the presence of a microorganism directly so that doctors can diagnose an infection quickly, without waiting for a person to produce antibodies in response to the microorganism.

Evaluation of colony morphology is not enough as it is not a definitive test. colonies of different bacteria can look the same, so it can help narrow.

What is antigen tests?

An antigen test is an immunoassays test used for the detection of a specific viral antigen that indicates current viral infections.

Hence, Antigen tests detect the presence of a microorganism whereas, Evaluation of colony morphology is not enough as it is not a definitive test.

To learn more about the Antigen  click here

https://brainly.com/question/14453511

How does air pollution affect human health?
a. Respiratory infections
b. Lung Cancer
c. Asthma
d. All of the Above

Answers

Answer:

The answer for this question is D

d is the correct answer

true or false
Photosynthesis is part of an oak tree's niche.

Answers

Answer:

True, veryyyyy true

:))

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

_______ Which vitamins and minerals must be listed on food labels?
a. vitamin D, vitamin C, iron and magnesium
b. vitamin C, calcium, iron and potassium
c. vitamin C, vitamin A, calcium and iron

Answers

I believe the answer is C

Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea

Answers

Answer:

Yes.

Explanation:

Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.

dead cells are removed from the Dermis by phagocytosis. true or false?​

Answers

The answer to your question is false I think.

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

Deoxyribose (sugar). Total number in image?

Answers

Answer:

Formula: C5H10O4

Molar mass: 134.13 g/mol

Solubility in water: Very soluble

Melting point: 91 °C (196 °F; 364 K)

Appearance: White solid

Classification: Pentose, Deoxy sugar

A father sheep has curly wool while a mother sheep has straight wool. Which of these statements explains why one of their baby lambs has curly wool?

Answers

Answer:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

Explanation:

This means that the baby sheep received the same set of genes as the father sheep giving it curly wool.

OR if the baby sheep received a mixed set of genes , one from father , the other from mother , the gene of the father is dominant over the gene of the mother and it has given the baby sheep curly wool.

During fertilization the baby must have received the same set of genes as those of its father. If the baby has received a mixed set of genes then the genes of the father are dominant over the genes of the mother resulting in curly wool.

The fathers gene may be dominant due to environmental circumstances or other factors.

Answer:

Explanation:The baby lamb inherited its copies of the gene for wool shape from its father and not from its mother. Just like its father’s genes, those genes instruct for proteins that connect in ways that make its wool curly.

How are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.

Answers

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.


Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

A limiting factor is a resource or other factor in the environment that can lower the population growth rate.

A. True
B. False

Answers

The answer is true.

How can a person cannot taste PTC I'd both of their parents have the ability to taste PTC?

Answers

Answer:

the parents are (Tt) and each passed down the recessive allele so the child is  (tt)

Explanation:

Thank you to anyone who answers .

Answers

Answer:

D

Explanation:

Answer:

i think its D but im so sorry if it wrong my second answer would probably be A

Explanation:

i really hope this helps sorry if it doesn't

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

Other Questions
I neeed help plsss hurry how many pregnancies per 100 women may occur in a year while using the patch Which of the following best describes Darwin's (and Wallace's) theory of evolution?Question 1 options:Organisms adapt during their individual lifetime and then pass on that adapted trait to their offspring.The different species appeared on our planet in a random fashion. There are no reasons for why animals are in the locations they are in or have the features they have.Galapagos finches have changed over time to get longer beaks to be able to eat the seeds on the islandThe diversity of life on our planet comes from the process of evolution supported by the mechanism of natural selection. Complete the sentences with the correct form of the verb ir to say where the people are going.Mis amigos _____ al cine para ver una pelcula. Solve the equation 23+n=29 using the inverse operation. 3. Ellis Island stopped processingimmigrants inO 1924.O 1954O 1964O 1984 Which of the following quotes best summarizes how the details included in the section Some Examples of the Unexpected relate to one another?The things we learn from our national space program will produce benefits in ways entirely unrelated to missiles or interplanetary travel.The implications of this knowledge for satellites near Earth or for reentering spacecraft are obvious.Noble gases are the least active substances known to chemistry; if they can adhere, it is clear that no specific forces are needed for adhesiveness.From this knowledge has come the recent development of a diaphragm-damping fluid surface which has real potential not only for underwater high-speed bodies, but for any vehicle where fast-moving gases or fluids may cause drag.PLS HELP ILL ONLY GIVE BRAINLIEST TO THE CORRECT ANSWER Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. HELP TIMED!!Suppose you draw a card from a well-shuffled deck of 52 cards. What is the probability of drawing a 7 or a queen? HELP I NEED HELP ASAPHELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAPHELP I NEED HELP ASAPHELP I NEED HELP ASAP HELP I NEED HELP ASAP HELP I NEED HELP ASAPA. Skewed RightB. UniformC. Skewed LeftD. Normal On a coordinate plane, what are the center and radius of the circle represented by(x+3)^2 + (y 5)^2 = 25?A. Center: (-3, 5); Radius: 25B. Center: (3, -5); Radius: 25C. Center: (3, -5); Radius: 5D. Center: (-3, 5); Radius: 5 ) Find the area of the shape. Is urgent please ,The purpose of an initial public offering (IPO) is to do what?A. Break into a monopoly marketB. Comply with government regulationsC. Raise moneyD. Get unlimited liabilitySUBMIT help again . ill give you 15 points. Examine Item A in your test documents. Which municipal area most likely hasthe least influence on elections due to the reapportionment shown?A. GardinerB. WoodstockC. ShawangunkD. Rochester Tell if the Ratio is Part-to-part or part-to-whole4 apples to 3 oranges please help me i'm going to give you brainless What is the name of the piece above? Question in the attachments how to factor y^2+49