Identify what holds DNA, the hereditary information of a cell?

(Its not the nucleus)

PLEASE HELP!

Answers

Answer 1

Answer:

chromatin network or chromosomes


Related Questions

Write mechanism of absorption​

Answers

Answer: The mechanism for absorption is that a photon transfers all its energy to an electron in the absorbing material. The photon is "lost" from the light beam as it is absorbed in a single event. The electron is excited by the gain in energy to a higher energy state in the electron configuration around the atom. (hope it helps)

Answer: I don't know

Explanation: i am brainless

pushing a chair requires less energy than pushing than pushing a desk because

A. The surface area of the desk is larger.

B. The desk has less mass then then the chair

C. The chair has less mass then the desk

D. The chair is smaller

Answers

Answer:

c

the chair has less mass then the desk

Which of the following best represents the purpose of fertilizers?

Answers

Answer:

Fertilizer, natural or artificial substance containing the chemical elements that improve growth and productiveness of plants. Fertilizers enhance the natural fertility of the soil or replace the chemical elements taken from the soil by previous crops.

When and where would you expect to find the highest rate of primary productivity

Answers

Answer: Net primary productivity is the amount of gross primary productivity remaining after respiration, which is about 40 and 85 percent. Sloughs and marshes, as well as tropical rain forests, possess the highest rates of net primary productivity; deserts have the lowest.

Explanation:

I explained on the top-

The highest rate of primary productivity in terrestrial environments takes place in swamps and marshes and in tropical rainforests, and in aquatic environments it takes place in algal beds, estuaries, and reefs.  

• In ecology, primary productivity refers to the rate at which conversion of energy to organic substances takes place by the photosynthetic producers that attain energy and nutrients from the sunlight, and chemosynthetic producers that attain chemical energy via oxidation.  

• The majority of the energy assimilated by plants via the process of photosynthesis is not stored as organic substance, however, is utilized at the time of cellular respiration.  

• In the process, the organic components like proteins, carbs, and fats are dissociated to provide energy in the form of ATP for the metabolic needs of the cells.  

• The energy not utilized is stored in the tissues of the plants for future use and is known as the net primary productivity.  

• The highest net primary productivity in terrestrial environments takes place in marshes and swamps and in tropical rainforests, and in aquatic environments it takes place algal beds, estuaries, and reefs.  

These environments are mainly critical for the sustenance of global biological productivity.

To know more about:

https://brainly.com/question/14017102

What are the non-living components of an ecosystem?

Answers

Answer:

- Abiotic factors refer to non-living physical and chemical elements in the ecosystem.

- Abiotic resources are usually obtained from the lithosphere, atmosphere, and hydrosphere.

- Examples of abiotic factors are water, air, soil, sunlight, and minerals.

what are the effects of a change in protein? there is 3

Answers

Generally, mutations result in reduced protein function or no protein function. A mutation with reduced function is called a leaky mutation because some of the wild-type function “leaks” through into the phenotype. A mutation that results in no protein function is called a null mutation

Explain how different types of cells help organisms live and grow?
Different types of cells have different jobs that are necessary to keep organisms alive.
Different types of cells are only found in specific types of organisms.
Cells are necessary in order for all organisms to grow big and hunt for their food source.
Cells provide support for all organisms to be able to move.

Answers

Answer:

Different types of cells have different jobs that are necessary to keep organisms alive. And cells also give the living animal more support. They also hold the genetic information of that organism in their nucules. This is with most cells but bacteria cells do not contain nucules.

two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad

Answers

Answer:

A. wheter the producers are located on land or in the water.

What was Darwins “
master work” titled

Answers

Answer:

Origin of Species by Means of Natural Selection

El estómago es un órgano parecido a un saco que contiene los alimentos y comienza a digerirlos segregando jugo gástrico. ¿De qué sistema o aparato es parte el estomago? *

Answers

Answer:

Sistema digestivo

Explanation:

Los principales sistemas del cuerpo humano son:

Sistema respiratorio, sistema circulatorio, sistema nervioso, sistema inmune, sistema digestivo, sistema óseo, sistema urinario, sistema reproductor y sistema muscular.

Como dice el enunciado, el estómago comienza a digerir los alimentos haciendo parte, así, del sistema digestivo cuya función es digerir los alimentos y absorber sus nutrientes.

When comparing fossil A to fossil B, which is most likely correct?
Air
Soil
Up
Fossil A
-Fossil B

Answers

Fossil B would most likely be correct in this situation

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

A single species can feed at only one tropic level

True

False

Answers

Answer: True sorry if I’m wrong.

Explanation:

Answer:

True

Explanation:

Starch is a polysaccharide used as a component of cell walls in plants.


True

False

Answers

Answer:

false

Explanation:

is type of carbohydrates

False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.

What are structural component of cell wall?

Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.

Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.

Learn more about cell wall, here:

https://brainly.com/question/965751

#SPJ2

Because it is ______ , fermentation _______ oxygen.



Answers:
aerobic/requires
anaerobic/requires
aerobic/does not require
anaerobic/does not require

Answers

Answer:

anaerobic/does not require

Explanation:

anaerobic occurs in the absence of oxygen

write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond​

Answers

(See the attached picture)

Direction: Write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond.

Answer:

The goal of the sperms’ journey to the egg is to fertilize it. To do so, the sperm cell must pass through a long and challenging path. This is one of the reasons why the total number of motile sperm cells is very important, and a key parameter for a man’s potential to reach pregnancy with his partner.

The sperms’ journey to the egg begins with millions of sperm cells that are released into the female reproductive tract during intercourse. The sperm cells gain their full ability to swim when they are ejaculated into the reproductive tract.

Upon ejaculation, the sperm cells are enclosed in a fluid called seminal plasma or semen, which is a mix of fluids from the testes, seminal vesicles, prostate, and the bulbourethral glands. The fluid contains elements which protect the sperm cells during their journey towards the egg. The semen thickens and helps the sperm cells stay inside the woman – as close as possible to the cervix, which is the “gate” to the egg.

Liquid extends from the cervix, allowing the sperm cells from the semen to swim into the cervix. Only the strongest sperm cells will make it this far. Once through the cervix, the sperm cells swim across the uterus and into the fallopian tubes.

I hope it helps!!

The sperm cell fertilizes the egg and forms a zygote, which is further divided into multiple cells and becomes a child. The division is the process of mitosis that takes place from the zygote to the child's development.

How is the zygote formed and developed?

The sperm and the ovum are produced by the process of meiosis from the male and female, respectively, and when both fertilize, the zygote is formed. The fertilized zygote is a single cell, but later that cell is further divided mitotically and forms a morula, then a blastula, and then the gastrula.

The cells of the gastrula undergo cell differentiation, different organs are developed, and the baby is finally formed. The child then continues to grow in size, and different organs grow and form the mature organ system. After a certain age, the reproductive organs start to mature and are capable of forming the gametes.

Hence, all of these events occurred from the zygote to the child's maturity.

Learn more about the zygote here.

https://brainly.com/question/465851

#SPJ2

99% of the GMOs on the planet are ____
or ____

Answers

Answer:

The answer would be pesticide producers and herbicide resisters.

Explanation:

Hope this helped!

what is a halflife in science?

Answers

One-half of the atomic nuclei of a radioactive sample to decay

If earth’s atmosphere is made up of 78% nitrogen, why is nitrogen a limiting factor for producers?
A.
Consumers respire all of the available nitrogen.

B.
Nitrogen is unusable in its liquid form.

C.
There are more plants than gaseous nitrogen.

D.
Nitrogen is unusable in its gaseous form.

Answers

d is the answerrrrrrrrrr

Which of the following is a subsystem of an organism?
a.cell
b.organ system
c.tissue
d.all of the above

Answers

D is the answer you are looking for

Answer:

d

Explanation:

If y'all know science can y'all do dis, it's a multiple-choice question
' What is the net force required to give a box of mass 5 kg an acceleration of 4 m/s2 ?'

Answers

The answer to the question is

The number 20.

Hope this helps you. Sorry if i am wrong.

The skull and vertebrae are part of the _________ in vertebrates. circulatory system endoskeleton nervous system exoskeleton Science

Answers

Answer:

Endoskeleton

Explanation:

Hope this helps!

Answer:

nerveos systum i think is tha anser

which process produce two genetically distinct haploid cells

Answers

Answer:  mitosis

Explanation:

Each Taxonomy (category) gets less and less specific as they go further down the list.

A. True

B. False

Answers

Answer:

B. False

Explanation:

The levels of classification, from broadest to most specific, include: kingdom, phylum, class, order, family, genus, and species.

Answer:

B. False

Explanation:

Taxonomy is the study of the general principles of scientific classification.

Summary of human nutrition ​

Answers

Answer:

Human nutrition is the process of which substances are Transformed into tissues and energy which are used up to mental and physical activities!

i need help with this question

Answers

Research Question: How does various water types affect the growth of plants?

Independent Variable: Type of water

Dependent variable: plant growth

Constants: Time period (2 weeks)

Controls: type of plant, amount of soil, etc (anything you want to remain constant throughout).

The diagram above illustrates the carbon cycle. Which of the Following components of the diagram represent carbon sinks?
A. marine photosynthesis and respiration
B. volcanoes and soil carbon
C. oceans and fossil carbon
D. factories and photosynthesis

Answers

Answer:

D) Factories and Photosynthesis

What does "synthesis" mean?
A. to read DNA

B. to tear apart

C. to make something

Answers

Answer:

I believe it is C to make something

C. To make something

is eczema recessive or dominant? explain why or how.

Answers

Answer:

When caused by CARD11 gene mutations, atopic dermatitis has an autosomal dominant inheritance pattern , which means one copy of the altered CARD11 gene in each cell is sufficient to cause the disorder.

Explanation:

pls mark brainlest

I’m confused help me pls

Answers

Claim: This process uses expensive fertilizers and pesticides to grow pest free crops which may be produced in excess. Explain the reasons why people would go against growing wheat this way.

Your answer: Here are 3 reasons that go against growing wheat this way.

1. The fertilizers and pesticides are expensive and cost farmers a lot which takes away from the revenue that farmers make from growing the crops in the first place.

2. Other then fertilizers and Pesticides its a lot of work as you can see on the chart throughout the year there are many things you must do too keep crops bug free and pest free this reason I'm explaining says that taking and doing all of this work for not pests/bugs is too much and not needed.

3. Fungicide Is needed a lot and incredibly expensive when you used/spray it on crops that much and point goes a lot more for large crops too.

If these reasons don't work, find factors that or counterclaims that go against this method of harvesting wheat. (This is what your supposed too do)

Other Questions
Part B: Find an irrational number that is between 9.5 and 9.7. Explain why it is irrational. Include the decimal approximation of the irrational number to the nearest hundredth. (3 points) The Autobiography of Benjamin Franklin provides which of these?> a series of journal entries written by Franklin about himself as a statesman, writer, inventor, and scientist> a series of essays written about Franklin as a statesman, writer, inventor and scientist> a close friend's impressions of Franklin as a statesman, writer, inventor and scientist>facts from Franklin about himself as a statesman, writer, inventor, and scientist Can someone answer this please What are the envisaged benefits of the proposed e-visa system pls help im failing lol Which side lengths form a right triangle? If 80 persons can perform a piece of work in 16 days of 10 hours each, howmany men will perform a piece of work twice as great in tenth part of the timeworking 8 hours a day supposing that three of the second set can do as muchwork as four of the first set? since fighting alqueda have president bush and obama exceeded their war powers authority since aumf 2001? Temperature and precipitation are characteristics of:a. longitudeb. climatec. vegetationd. latitude HELLLLLLLPPPPPPPPPPPP A manufacturer claims that the mean lifetime,u , of its light bulbs is 51 months. The standard deviation of these lifetimes is 7 months. Sixty bulbs are selected at random, and their mean lifetime is found to be 53 months. Can we conclude, at the 0.1 level of significance, that the mean lifetime of light bulbs made by this manufacturer differs from 51 months?Perform a two-tailed test. Then fill in the table below.Carry your intermediate computations to at least three decimal places, and round your responses as specified in the table. (If necessary, consult a list of formulas.)the null hypothesis:The alternative hypotehsis:The type of test statistic (choose Z, t, Chi-square, or F)The value of the test statistic (round to at least three decimal places:Can we conclude that the mean lifetime of the bulbs made by this manufacture differ from 51 months? Which womens suffrage leaders led the Seneca Falls Convention?A.Susan B. Anthony and Carrie Chapman CattB.Alice Paul and Lucy BurnsC.Elizabeth Cady Stanton and Lucretia MottD.Woodrow Wilson and Susan B. Anthony Which statement is true of free verse?Free verse doesnt use figurative language.Free verse does not include lines that rhyme at the end.Free verse has a stronger mood and tone than formal poetry.Free verse never includes a pattern of sounds. What is the significance of the Battle of Yorktown?A. The British won the warB. It led to the start of peace negotiationsC. It completely ended fighting in North AmericaD. It caused France to join the war explain why 7x+3 cannot be factorised what is substances ????? A radio signal carrying Morse code on a continuous wave that is switched on and off is more reliable than a radio signal that uses modulation to convey information. This is because it takes more power for a modulated radio wave to reach its destination than it does for a continuous wave to reach its destination. Above passage is an:_________ Which word from paragraph 1 helps the reader understand the meaning of the word compassion in paragraph 1? A. admired B. cared C. dignity D. hope As were well aware, vending machines are used to sell snacks and beverages, whereas newspapers are sold out of a box that allows anyone to take more than one paper. How does the concept of diminishing marginal utility explain the different distribution techniques for newspapers vs. snacks and beverages? Identify two additional examples of an item whose diminishing marginal utility is high. Remember: Marginal utility is the change in total utility that results from a one-unit increase in the quantity of a good consumed; diminishing marginal utility is the general tendency for marginal utility to decrease as the quantity of a good consumed increases. What was a major difference between Deng Xiaoping's and Mao Zedong'spolicies as the leaders of the People's Republic of China?A. Deng Xiaoping banned all forms of Western media, while MaoZedong encouraged Westernization in China.B. Deng Xiaoping hoped to destroy Chinese traditions, while MaoZedong defended traditional Chinese culture.C. Deng Xiaoping promoted free market policies, while Mao Zedongopposed noncommunist economic systems.D. Deng Xiaoping called for open elections in China, while MaoZedong was a dictator with absolute power. The viscid silk produced by the European garden spider (Araneus diadematus) has a resilience of 0.35. If 10.0 J of work are done on the silk to stretch it out, how many Joules of work are released as thermal energy as it relaxes?