HURRYY, 50 PTS AND ILL MARK AS BRAINLIST !!

describe the interrelationships between the skeletal systems and the integumentary, muscular, cardiovascular and urinary systems

Answers

Answer 1

Answer:

Without the skeletal system holding the body together and supporting structure, the muscular, cardiovascular, and urinary systems would be crushed under the impact of our body mass.

Explanation:


Related Questions

The template strand for a new DNA molecule reads 5' CCTGAATT 3'. What will be the nitrogen base sequence for the complementary strand created during DNA replication?

Answers

Answer:

3' GGACTTAA 5'

Explanation:

because Adenine always pair with Thymine and Cytosine with guanine. u can also remember them as Apple Tree and Car Garage

If earth’s atmosphere is made up of 78% nitrogen, why is nitrogen a limiting factor for producers?
A.
Consumers respire all of the available nitrogen.

B.
Nitrogen is unusable in its liquid form.

C.
There are more plants than gaseous nitrogen.

D.
Nitrogen is unusable in its gaseous form.

Answers

d is the answerrrrrrrrrr

What are the non-living components of an ecosystem?

Answers

Answer:

- Abiotic factors refer to non-living physical and chemical elements in the ecosystem.

- Abiotic resources are usually obtained from the lithosphere, atmosphere, and hydrosphere.

- Examples of abiotic factors are water, air, soil, sunlight, and minerals.

Explain how different types of cells help organisms live and grow?
Different types of cells have different jobs that are necessary to keep organisms alive.
Different types of cells are only found in specific types of organisms.
Cells are necessary in order for all organisms to grow big and hunt for their food source.
Cells provide support for all organisms to be able to move.

Answers

Answer:

Different types of cells have different jobs that are necessary to keep organisms alive. And cells also give the living animal more support. They also hold the genetic information of that organism in their nucules. This is with most cells but bacteria cells do not contain nucules.

write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond​

Answers

(See the attached picture)

Direction: Write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond.

Answer:

The goal of the sperms’ journey to the egg is to fertilize it. To do so, the sperm cell must pass through a long and challenging path. This is one of the reasons why the total number of motile sperm cells is very important, and a key parameter for a man’s potential to reach pregnancy with his partner.

The sperms’ journey to the egg begins with millions of sperm cells that are released into the female reproductive tract during intercourse. The sperm cells gain their full ability to swim when they are ejaculated into the reproductive tract.

Upon ejaculation, the sperm cells are enclosed in a fluid called seminal plasma or semen, which is a mix of fluids from the testes, seminal vesicles, prostate, and the bulbourethral glands. The fluid contains elements which protect the sperm cells during their journey towards the egg. The semen thickens and helps the sperm cells stay inside the woman – as close as possible to the cervix, which is the “gate” to the egg.

Liquid extends from the cervix, allowing the sperm cells from the semen to swim into the cervix. Only the strongest sperm cells will make it this far. Once through the cervix, the sperm cells swim across the uterus and into the fallopian tubes.

I hope it helps!!

The sperm cell fertilizes the egg and forms a zygote, which is further divided into multiple cells and becomes a child. The division is the process of mitosis that takes place from the zygote to the child's development.

How is the zygote formed and developed?

The sperm and the ovum are produced by the process of meiosis from the male and female, respectively, and when both fertilize, the zygote is formed. The fertilized zygote is a single cell, but later that cell is further divided mitotically and forms a morula, then a blastula, and then the gastrula.

The cells of the gastrula undergo cell differentiation, different organs are developed, and the baby is finally formed. The child then continues to grow in size, and different organs grow and form the mature organ system. After a certain age, the reproductive organs start to mature and are capable of forming the gametes.

Hence, all of these events occurred from the zygote to the child's maturity.

Learn more about the zygote here.

https://brainly.com/question/465851

#SPJ2

Write mechanism of absorption​

Answers

Answer: The mechanism for absorption is that a photon transfers all its energy to an electron in the absorbing material. The photon is "lost" from the light beam as it is absorbed in a single event. The electron is excited by the gain in energy to a higher energy state in the electron configuration around the atom. (hope it helps)

Answer: I don't know

Explanation: i am brainless

Starch is a polysaccharide used as a component of cell walls in plants.


True

False

Answers

Answer:

false

Explanation:

is type of carbohydrates

False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.

What are structural component of cell wall?

Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.

Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.

Learn more about cell wall, here:

https://brainly.com/question/965751

#SPJ2

is eczema recessive or dominant? explain why or how.

Answers

Answer:

When caused by CARD11 gene mutations, atopic dermatitis has an autosomal dominant inheritance pattern , which means one copy of the altered CARD11 gene in each cell is sufficient to cause the disorder.

Explanation:

pls mark brainlest

What is photosynthesis ​

Answers

ANSWER:

Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's metabolic activities.

CARRYONLEARNING(◕ᴗ◕✿)

photosynthesis is the process in which light energy is absorbed by chlorophyll and converted into chemical energy to form glucose

Each Taxonomy (category) gets less and less specific as they go further down the list.

A. True

B. False

Answers

Answer:

B. False

Explanation:

The levels of classification, from broadest to most specific, include: kingdom, phylum, class, order, family, genus, and species.

Answer:

B. False

Explanation:

Taxonomy is the study of the general principles of scientific classification.

two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad

Answers

Answer:

A. wheter the producers are located on land or in the water.

A single species can feed at only one tropic level

True

False

Answers

Answer: True sorry if I’m wrong.

Explanation:

Answer:

True

Explanation:

which process produce two genetically distinct haploid cells

Answers

Answer:  mitosis

Explanation:

PLEASE HELP I WILL GIVE BRAINALIST

Answers

Answer:

DNA is double-stranded, but only one strand serves as a template for transcription at any given time. This template strand is called the noncoding strand. ... In most organisms, the strand of DNA that serves as the template for one gene may be the nontemplate strand for other genes within the same chromosome.

Answer:

35. I think ture

36 . true

37.i think False

38.T but it is complementary base pairing

39.

40.you have to use amino acid table for this

The diagram above illustrates the carbon cycle. Which of the Following components of the diagram represent carbon sinks?
A. marine photosynthesis and respiration
B. volcanoes and soil carbon
C. oceans and fossil carbon
D. factories and photosynthesis

Answers

Answer:

D) Factories and Photosynthesis

Because it is ______ , fermentation _______ oxygen.



Answers:
aerobic/requires
anaerobic/requires
aerobic/does not require
anaerobic/does not require

Answers

Answer:

anaerobic/does not require

Explanation:

anaerobic occurs in the absence of oxygen

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

i need help with this question

Answers

Research Question: How does various water types affect the growth of plants?

Independent Variable: Type of water

Dependent variable: plant growth

Constants: Time period (2 weeks)

Controls: type of plant, amount of soil, etc (anything you want to remain constant throughout).

The skull and vertebrae are part of the _________ in vertebrates. circulatory system endoskeleton nervous system exoskeleton Science

Answers

Answer:

Endoskeleton

Explanation:

Hope this helps!

Answer:

nerveos systum i think is tha anser

99% of the GMOs on the planet are ____
or ____

Answers

Answer:

The answer would be pesticide producers and herbicide resisters.

Explanation:

Hope this helped!

WILL IVE BRAIN?? Why might humans not have widespread regeneration abilities?

Answers

Answer: because mammals have more complex biological structures; limb regeneration would require sophisticated controls to ensure that limbs and organs don’t grow out of control.

Explanation:

What does the prefix "hetero-" mean?
A. Same

B. Different

Answers

I would say different
Like you like different genders

Answer:

B. Different

Explanation:

If y'all know science can y'all do dis, it's a multiple-choice question
' What is the net force required to give a box of mass 5 kg an acceleration of 4 m/s2 ?'

Answers

The answer to the question is

The number 20.

Hope this helps you. Sorry if i am wrong.

Summary of human nutrition ​

Answers

Answer:

Human nutrition is the process of which substances are Transformed into tissues and energy which are used up to mental and physical activities!

Mr. and Mrs. Green have a daughter, Georgia, who was born at Riverside Community Hospital. Mr. and Mrs. Blue have a daughter, Belle, who was born on the same date at the same hospital. Mrs. Green, having recently seen Belle, is convinced that Belle and Georgia had been assigned to the wrong parents at the hospital. Mrs. Green thinks that Belle is her biological daughter. ABO blood analysis was performed on all individuals involved:Mr. Green: Type AMrs. Green: Type A Georgia: Type AMr. Blue: Type ABMrs. Blue: Type ABelle: Type O
Is Mrs. Green correct? Is Belle her biological daughter? Explain.

Answers

Answer:

Yes, Mrs Green is correct that Belle is her biological daughter

Explanation:

According to this question, Mr. and Mrs. Green is said to have a daughter, Georgia while Mr. and Mrs. Blue is said to have a daughter, Belle. Both daughters were born the same day. Hence, a controversy occured as Mrs. Green thinks that Belle is her biological daughter.

Based on the blood analysis, the following were obtained:

Mr. Green: Type A

Mrs. Green: Type A

Georgia: Type A

Mr. Blue: Type AB

Mrs. Blue: Type A

Belle: Type O

The genotype of the following blood types is as follows:

Type A - iAiA or iAi

Type B - iBiB or iBi

Type O - ii

Type AB - iAiB

From the analysis of blood types of Mr and Mrs Green, which are both type A, they can possibly produce a child with type A.

However, from the analysis of Mr. and Mrs. Blue, it is impossible to have a child with blood type O. However it is possible for Mr and Mrs. Green if they are both heterozygous (iAi × iAi). The punnet square is attached. Hence, Mrs Green is correct about her claim since Mr. and Mrs. Blue cannot have a child with blood type A.


What elements are in the most common substance in the human body?
A. Carbon and nitrogen
B. Hydrogen and oxygen
C. Oxygen and phosphorus
D. Calcium and nitrogen

Answers

B hydrogen and oxygen

Which of the following best describes the function of the human nervous system? ​

Answers

Answer:

The nervous system gathers, interprets, and responds to information about the body's internal and external environment.

Identify what holds DNA, the hereditary information of a cell?

(Its not the nucleus)

PLEASE HELP!

Answers

Answer:

chromatin network or chromosomes

Which of the following best represents the purpose of fertilizers?

Answers

Answer:

Fertilizer, natural or artificial substance containing the chemical elements that improve growth and productiveness of plants. Fertilizers enhance the natural fertility of the soil or replace the chemical elements taken from the soil by previous crops.

HELP!!!

The tissues that develop from
of a zygote are the direct result of:
a. Meiosis and fertilization
B. Fertilization and differentiation
C. Asexual reproduction and meiosis
D. Differentiation, later,
Fertilization

Answers

Answer:

D. differentiation, later, fertilization

Other Questions
Frankenstein Worksheet #5 (pp. 126-131)1. Directions: Answer the following question as completely as possible.Discuss your final thoughts on the novel. Explain why you liked or disliked the ending. Briefly discuss yourviews on how the two main characters change in positive or negative ways - Victor Frankenstein, or the Creature?In other words, who is the real villain of the story? Its about McDonalds Triple Thick Shack!!! 1.How many grams of carbohydrates would you take in if you split this shake with a friend??2. How much of your daily intake of cholesterol does this shake provide?? Which of the following placed a pause on the Civil War in China during the 1930s?A-an invasion by JapanB-an invasion by the United StatesC-an invasion by RussiaD-an invasion by Germany Whats the answer. Please help. PLSSS HELP MEEEEEEEEIt takes 5 seconds for a wave with a wavelength of 0.4 m to travel past you.What is the frequency of the wave?A. 2.0 HzB. 0.2 HzC. 5 HzD. 2.5 Hz Classify the triangle by its angles and sides.acute isoscelesacute scaleneequiangular equilateralobtuse isosceles Which of the following is the simplified form of? Jx/xVx?oxx21O 21 /Points eamed on this question: 0 Please translate Ill give brainliest Which of the following scenerios fits all of the criteria for the two-source interference equations to be valid?a. An observer is standing far away from two red LED signal lights.b. Light from an incandescent bulb shines onto a screen with a single slit; then the light shines onto a screen with two slits in it and the light from the two slits finally shines onto a far-away screen.c. An observer stands on a road far away from two neighboring radio towers for different radio stations.d. Light from an incandescent bulb shines onto a screen with a single slit; then the light shines onto a screen with two slits in it and the light from the two slits finally shines onto a nearby screen.e. An observer stands on a road that runs five kilometers away from the two synchronized transmitting towers for a radio station. URGENT PLEASE HELP: Simplify Question 14 of 14Which expression gives the distance between the points(1,-2) and (2, 4)?O A. (1+23 +(2-47O B. (1-2)*+(-2-4)O c. 111-23 +4:32-47O D. Hit+2y +(2-479 The ratio of coloured paper the white paper is 3:8 if there are 48 white paper how many coloured paper are there There were 436 tickets purchased for a major league baseball game. The general admission tickets cost $6.50 and the upper reserved tickets cost $8.00. The total amount of money spent was $3284.00. How many of each kind of ticket were purchased?How many general admission tickets were purchased? ____How many upper reserved tickets we purchased? ___ In this passage, Nick tells Daisy and Tom that he isnot engaged. Based on this passage, whichconflict is most likely to develop? Of the 25 students who take a standardized test, the minimum score is 98 and the maximum score is 312. The mean score is 216. Standard deviation is 52. What is the number of standard deviations that includes all the data values? There is a Chick-fil-a exactly 6 miles due east of Berkmar Middle School. There is also a Wal-Mart 6 miles due north of Berkmar Middle School. How far is the Chick-fil-a from the Wal-Mart? Leave your answer in its simplest radical form. What is the slope of a line parallel to a)-1/2b)-2c)1/2d)2 There are, for example, the Spartans and the Romans. The Spartans held Athens and Thebes, establishing there an oligarchy: nevertheless they lost them. The Romans, in order to hold Capua, Carthage, and Numantia, dismantled them, and did not lose them. They wished to hold Greece as the Spartans held it, making it free and permitting its laws, and did not succeed. How does the text structure help the author convey his central idea in this chapter? By describing the actions taken by the Spartans and the Romans, Machiavelli sets up a comparison with the actions of other conquering forces discussed in the chapter. By contrasting the outcomes of Spartan and Roman conquests, Machiavelli provides evidence to support his claim that a prince must destroy a free city in order to hold it. By contrasting the goals of the Spartans and the Romans, Machiavelli establishes the problem of maintaining control of a conquered city, to which he will propose a solution. By listing the effects of these Spartan and Roman conquests, Machiavelli supports his overall description of how princes do or do not maintain control over the cities they conquer. Given: line a line b. If m7 = 63 , then m4 = __ ? __. 4. Temperature graphs from two cities on July 1 are shown below. Which statement is true?O A. City A experienced a bigger temperature change than City B.O B. City B experienced a bigger temperature change than City A.O C. The low temperature in City B was lower than the low temperature in City A.O D. Both B and C are true.