Human Bones
Name three components of bones and describe
their function.

Answers

Answer 1

Answer: 1st the periostneum which is the outside of the bone and a thin but dense layer that has nerves and blood vessels

2nd compact bone. It is very smooth and very hard

3rd and lastly Cancellous, this looks a little like a sponge but much harder.

Explanation:

Answer 2

Answer:

The periosteum is a thin, dense membrane that contains nerves and blood vessels that nourish the bone.

Compact bone is smooth and dense. It is the hard part of the bone.

Cancellous bone looks like a sponge and protects the bone marrow.

Bone marrow is a thick jelly that makes blood cells.

Explanation:

These are the check offs for edge 2021


Related Questions

steps of Biological method of study taking malaria as an examples

Answers

Explanation:

The different steps which are involved in biological method are the the invasion, the rapid division followed by the spread of infection. ... Malaria results in infection after the bite of the female anopheles mosquito. The parasites enter the bloodstream. as a result of this there is predominant infection.

Metamorphosis is:______.a. changing of one body form to another within a species, such as the change from an aquatic tadpole to a terrestrial frog. b. an intermediate condition, such as length of legs in mice between longer legs of some mice and shorter legs in others, a condition caused by Hox genes. c. the evolutionary transition from fishes to amphibians. d. the developmental changing of a scale to a feather.

Answers

Answer:

changing i think

Explanation:

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

Which is most likely a source of air pollution? littering CFCs oil spill runoff

Answers

Answer: CFCs

Explanation: The other options aren’t as relevant to air pollution.

Answer:

cfcs

Explanation:

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Which of the following is a distinct structure found specifically in the liver, spleen, and bone marrow?
Select one:
a. Sinusoidal capillaries
b. Fenestrated capillaries
c. Venous sinus
d. AV anastomoses
e. Continuous capillaries​

Answers

Answer:

option A is correct

Explanation:

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

Which element is being cycled through Earth's system in the image shown
below?
Fossil fuels
Cellular
respiration
Photosynthesis
Animals
Plants
Industry and Home
Death and
decay
A. Oxygen
B. Nitrogen
c. Hydrogen
O D. Carbon

Answers

I took this quiz about 2 weeks ago but I forgot the answer. I think it was Carbon but you shouldn’t trust me till someone confirms it
carbon! hope this helps!!

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

Write TRUE or FALSE
(a)
A 'system' is the part of an organism that carries out a certain function.​

Answers

Answer:

TRUE

Explanation:

Why is environmental science important?

Answers

Explanation:

it is where we live and share resources with order species

I hope this was helpful

what action is a reflex action

Answers

Answer:

A reflex action is an involuntary , quick  response to a stimulus, which minimises any damage to the body from potentially harmful conditions, such as touching something hot.

Explanation:

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

The dark organelles labelled E is called the Ribosomes.    

The answer is Ribosomes

The image shows groundwater zones. Top to bottom: Porous rock or soil, Water, Impermeable rock. Zone 1 is at the top of porous rock. Zone 2 is between porous rock and water. Zone 3 is in the Water. Zone 4 is between the Water and Impermeable rock. Which is the saturated zone?

Answers

Answer:

zone 3

Explanation:

Answer:

C

Explanation:

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

Why was the Nationalist Party more popular in China’s cities than in the countryside? Wealthy people who supported the party were concentrated in cities. People in the countryside were less active in politics than people in the city. Poor city dwellers hoped the Nationalist Party would bring economic change. The Nationalist Party threatened to end crop trade with Western nations.

Answers

Answer:

Wealthy people who supported the party were concentrated in cities.

Explanation:

Answer:

The answer is A on edge

Explanation:

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

Only ------ percent of the food eaten is turned into its own body. *



20%

12%

10%

40%​

Answers

Answer:

12% I think this is right answer v

guy plz chat with me

Answer:

the answer is 10%

Explanation:

the 10% rule states that only 10% of energy is passed from one trophic level to the other (organism to organism)

I have four brothers
"This is what type of
observation?

Answers

Quantatative data since it is physically counting

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

Ultra-high-temperature sterilization effectively reduces microbes that cause spoilage. removes only mesophilic microbes. reduces microbes that cause disease. removes all microbes that cause diseases or spoilage. reduces microbes that cause disease or spoilage.

Answers

Answer:

kills all microbes that cause disease or spoilage.

Explanation:

There are different methods of sterilization, such as ultraviolet radiation, autoclave mechanisms, etc.

The sterilization mechanisms eliminate the microorganisms completely, thus generating sterile surfaces.

These mechanisms are used with surgical instruments, the operating room environment.

The autoclave method is the most widely used today due to its economical price, its ease of use and its practicality.

Sterilization methods must be strictly controlled with pilot or test microbiological cultures to be able to corroborate that these mechanisms function correctly, since otherwise they could trigger strong pathologies due to cross contamination.

what type of cash crops have been genetically modified..... please help!!!!!

Answers

Answer:

Most food modifications have primarily focused on cash crops in high demand by farmers such as soybean, corn, canola, and cotton. Genetically modified crops have been engineered for resistance to pathogens and herbicides and for better nutrient profiles.

Explanation:

Other Questions
In a given set of data, if the variance is 25, what is the standard deviation? * Combine the radicals. 35-85+25 The price of a stock decreased by 60 cents one week, decreased 10 cents the next week, and decreased another 20 cents the following week. What is the average change in the price of the stock over the three weeks? need to know right now ASAP!! 270 cents per week 90 cents per week 87 cents per week 30 cents per week If two of the ordered pairs was removed which two data points will cause the correlation to decrease the most? Select Two points1) Data point A2) Data point B3) Data point C4) Data point D Musah stands at the center of a rectangular field.He takes 50 steps north,then 25 steps West and finally 50 on a bearing of 315. Sketch Musah's movement How far west is Musah's final point from the center? How far north is Musah's final point from the center? 50 POINTS!Choose a stanza from any poem, including those in this lesson. Write a paraphrase of those lines. Then compare the original stanza with the paraphrase. What has changed in the transition from poetry to prose? what is (a x b) x c, if a = 11, b = 9, and c = 1? PLEASE HELP!!! need help on this very very easy question plz Which statements are true about "evidence"? select all that apply observations which answer questions proof that an idea is true information for or against an idea data to help draw a conclusion Zach keeps his pet chameleon Pinky in a terrarium with the dimensions shown below. There's sand in the bottom of the terrarium that reaches a height of 8 centimeters. Zach gets a new terrarium for Pinky that is larger. The base of the new terrarium is 25 by 64 centimeters. Zach moved the existing sand to the new terrarium. does successfully completing a driver education courseguarantee that you become a safe driver??a. Trueb. False arner HomeClasswork for Alge.VNext >Pretest: Circles with and Without CoordinatesSubmit TestReade18The curved parts of the figure are arcs centered at points A and C. What is the approximate length of boundary ABCD? Use the value = 3and round the answer to one decimal place.5301205 why would you perform a pain assessment on a patient? The seller told the listing broker that the seller's loan was assumable. Upon reviewing the seller's loan documents the listing broker found the mortgage was not assumable and the seller would have to pay off the mortgage upon sale. What clause did the listing broker discover upon reading the mortgage document Modern farming methods require moreinputs which are manufactured in industry. Do youagree? Barbara Cusumano worked 60 hours last week. Of those hours, 40 hours were paid at the regular-time rate of $12.50 an hour, 18 hours at the time-and-a-half rate, and 2 hours at the double-time rate. What was Barbara's gross pay for the week? How many significant figures does each value contain? 5.6803 kg has significant figures. 0.00047 seconds has significant figures. 0.240 miles has significant figures. A speeding car has a velocity of 80 mph; suddenly it passes a cop car but does not stop. When the speeding car passes the cop car, the cop immediately accelerates his vehicle from 0 to 90 mph in 4.5 seconds. The cop car has a maximum velocity of 90 mph. At what time does the cop car meet the speeding car and at what distance? Match each function formula with the corresponding transformation of the parent function y = 3x 1. y = -3^ x Translated up by 1 unit 2. 2.y = 3^ -x Reflected over the y-axis 3. 3.y = 3 ^x - 2 Translated right by 2 units 4.4. y = 3 ^x + 1 Translated down by 2 units 5.5. y = 3^ x + 1 Translated left by 1 unit 6.6. y = 3 ^x - 2 Reflected over the x-axisEverything is exponents of the three except the -2 at the end and the 4th one is also +1 not an exponent PLEASE HELP WILL GIVE BRAINLIEST AND THX Which ratios have a unit rate of 3? Choose all that apply. 15/2 cups: 2 1/2 cups 1 cup: 1/4 cups 2/3 cups: 1 cup 3 3/4 cups: 2 cups 2 cups: 2/3 cups 2 1/2 cups: 5/6 cups