how does pollution travel from a river to the ocean?

a) pollution flows upstream toward the ocean

b) pollution flows downstream toward the ocean

c) pollution flows toward the bank of a river and then to the ocean

d) pollution flows toward the source of a river

How Does Pollution Travel From A River To The Ocean?a) Pollution Flows Upstream Toward The Ocean B) Pollution

Answers

Answer 1

Answer:

d

Explanation:

Answer 2
I would say d, because the other guy said d

Related Questions

What is the mrna sequce of the T T C A A T G G T C T A G G G

Answers

Answer:

AAGTTACCAGATCCC

Explanation:

always remember, you would just switch them, The Opposite Of T is A and The Opposite of G is C,  and vise versa.

If you find a fossil in two different locations and it has featured in common with dinosaurs and modern birds, how does this support the evolutionary theory?

a) the two species must not be related
b) looking at the fossils, they show similarities both physically and in their DNA that don't appear to change much over time
c) dinosaurs must have evolved from mammals because their bones are similar in size rather than birds
d) the land must have been together at one point where these two species interbred to share a common ancestor

Answers

Answer: D

Explanation: the continents wee once connected. It was known as Pangea

At high altitudes, air is less dense than at sea level because of decreased air pressure. This means that a person who ascends to high altitudes takes in fewer oxygen molecules per breath. Describe and explain an immediate response that occurs in the circulatory system when a person first reaches high altitudes. Use vocabulary from class.

Answers

An immediate response that occurs in the circulatory system when a person first reaches high altitudes is that the heart beats faster to meet the demand for oxygen that the body needs.

What are the main effects of altitude?

The higher it is, the worse the symptoms, which include

headacheshortness of breathrapid heartbeatamong others

Not everyone has these symptoms when they go to high-altitude places, but it is also not possible to know who will or will not feel something.

With this information, we can conclude that An immediate response that occurs in the circulatory system when a person first reaches high altitudes is that the heart beats faster to meet the demand for oxygen that the body needs.

Learn more about high-altitude in brainly.com/question/14756132

#SPJ2

PLSSS HELP IMMEDIATELY!!!!! i need help rn!! only help if u know, i’ll give brainiest if u don’t leave a link

Answers

Answer:

Its keen eye sight helps it to see prey from the sky

Explanation:

Second option, doesn't make sense because their white and brown feathers aren't used for camoflouge  

Third option, bald eagles fly not swim

Fourth option, bald eagles use their beaks for critical tasks, such as building nests, catching food and preening.

A population of lowers is separated by an eight-lane superhighwax, Pollen is often camed by the
and across the highway and can pollinate the flowers on the other side of the highway Can speciation

occur in this situanon2
No because the populations are not reproductively isolated
Ne because the populanons are not geographically isolated
Ces because the populations are reproductively isolated
Yes because the populations are geographically isolated
DONE
Fr

Answers

Answer:

hi

Explanation:

Answer: A) No, because the populations are not reproductively isolated.

Explanation:   :)

Do you think aluminum foil is a good insulator or conductor? Why? Give data ( I'm talking about numbers here)

Answers

Answer: hewo, There! your Answer is Below ;w;

aluminum foil reflects the emission of heat, it tends to be a better insulator than other materials that just slow down the flow of heat from one area to another. So It is a Good Insulator,

Explanation:

aluminum foil is a good insulator because it prevents the radiation of heat by reflecting it back at the source.

Hope this helps!

Have a great day!!!

-August-

Which problem do you think contributes most to water scarcity?

Answers

Answer:

QUESTION:

Which problem do you think contributes most to water scarcity?

ANSWER:

Water shortages may be caused by climate change, such as altered weather patterns including droughts or floods, increased pollution, and increased human demand and overuse of water. A water crisis is a situation where the available potable, unpolluted water within a region is less than that region's demand.

Explanation:

Hope that this helps you out! :)          

If you have any questions please put them in the comment section below this answer.          

Have a great rest of your day/night!          

Please thank me on my profile if this answer has helped you.  

A man has Huntington's disease (a dominant trait) and a heterozygous genotype. He has four children with a woman who does not have Huntington's disease. What are the odds their children will inherit Huntington's disease?

Answers

Answer:

50/50

Explanation:

2. Describe the info flow of transcription. (A. DNA --> DNA / B. DNA -> RNA / C. RNA --> protein / D.
DNA --> protein)
3. Describe the info flow of translation. (A. DNA -> DNA / B. DNA -> RNA / C. RNA --> protein / D. DNA-
-> protein)
4. Describe the info flow of expression. (A. DNA --> DNA/B. DNA --> RNA / C. RNA --> protein / D. DNA
--> protein)
5. Describe the info flow of replication. (A. DNA --> DNA/B. DNA --> RNA / C. RNA --> protein / D. DNA-
-> protein)

Answers

Answer:

I think the dna is like in the butt but I really have no key to my hose

Explanation:

jsnfjfnf

What type of microscope would you use to view a live sample?
1. Scanning Electron Microscope
2.Transmission Electron Microscope
3.Magnifying glass
4. Light Microscope

Answers

Answer:

Compound microscopes

Compound microscopes are light illuminated. The image seen with this type of microscope is two dimensional. This microscope is the most commonly used. You can view individual cells, even living ones.

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answers

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

please help me with my science will give brainlest help asap 2 question, please dont answer just for points :(

Answers

Answer:

1. 50cm

2. Direct

Explanation:

1. The distance pulled back means you get your answer from the distance pulled back data. Since 50cm is the largest of your given data, that makes the cart go farthest.

2. The farther you pull the band back, the farther the cart will go. Since both increase when you increase the distance you pull the band back, this is a direct relationship.

Which of these mammals are native to Virginia

Armadillo

Camel

Kangaroo

Squirrel
(Don’t leave links)

Answers

Answer:

Right a way, we know that a camel or a kangaroo are NOT native to Virginia. Now we have the armadillo and the squirrel.

"Originally native to South America, the armadillo now ranges as far north as Texas, Oklahoma, Kansas, Louisiana and Florida." - so we can rule out armadillos!

Virginia has 4 different kinds of squirrels that are native, so squirrel would be your answer.

Hoped this helps!

Why is it we cannot directly observe a genotype, but can sometimes infer it?

Answers

We cannot directly observe a genotype because there are multiple options for genotypes.

What is the most common type of ocean pollution?

Answers

Cigarette butts are the most common form of marine litter.

Write your explanation of the role of genetics in Natural and Artificial Selection. Write on how environmental factors affect the survival based on Natural and Artificial Selection.

Answers

Natural selection is the survival of the fittest. Basically the organisms that best suit the environment they’re in will survive, and the less suited will pass. Artificial selection is when humans intervene and breed plants and animals to have desired traits. Like if one turtle has a longer neck than the other, and the plants are really tall in an area, people might selectively breed them so less turtles are dying of hunger.

Whenever energy appears in one system,
A.
it must have come from somewhere else.
B.
it means the system is suitable for creating energy.
C.
it must be used quickly or it will be permanently lost.
D.
it means energy creation has outpaced energy destruction.

Answers

Answer:

it must have come from somewhere else.

Explanation:

I did it on studyisland

I NEED HELP ASAPPP PLEASE
C. When the arm extends (straightens), which muscle contracts?

Answers

Explanation:

When your biceps muscle in your upper arm contracts, it pulls your lower arm in towards your shoulder. However, when it relaxes, your biceps cannot push your arm back out. To do this, your triceps muscle, on the underside of your upper arm, contracts and straightens your arm out.

Answer:

When your biceps muscle in your higher arm contracts, it pulls your lower arm in to your shoulder. when it relaxes, your biceps cant push your arm back out.  and straightens your arm out.

Explanation:

hey can someone answer pls?
will mark branliest and follow thanks!​

Answers

A is  correct

////

key word different

AAAAAAAAAAAAAAAAAAAA

Observing Animals (Image Attached)
Let’s study and compare three animals: a frog, an ancient and extinct mammal-like animal, and an owl. Observe the illustrations, and then answer the questions.

1. How are the bodies of the three animals similar to one another? How are they different?

2. What might these similarities suggest about the common ancestor of these organisms?

Answers

Answer: They each have patches on their stomachs. Also, all 3 animals have claws or legs, even though they play different function in each organism, they 3 still share the same characteristics of having claws or legs.

Explanation:

I am also trying to understand the 2nd question, but this is the answer to the 1st one.

How do the posterior pituitary gland and the anterior pituitary gland differ in structure ?

Answers

The anterior pituitary receives signalling molecules from the hypothalamus, and in response, synthesizes and secretes seven hormones. The posterior pituitary does not produce any hormones of its own; instead, it stores and secretes two hormones made in the hypothalamus.

Answer:

they differ like

Explanation:

The anterior pituitary receives signalling molecules from the hypothalamus, and in response, synthesizes and secretes seven hormones. The posterior pituitary does not produce any hormones of its own; instead, it stores and secretes two hormones made in the hypothalamus.

Humans, and other animals, exhale
A. oxygen

B. natural gas

C. carbon dioxide

D. cytoplasm

Answers

Answer:

C

Explanation:

Humans,and other animals,exhale carbon dioxide and inhale oxygen.

Answer:

c: humand and animals exhale carbon dioxide

Some flowers show incomplete dominance. If RR = white and R'R' = red, which phenotypic ratio would
be expected in the o spring of two pink flowers?

Answers

Answer:

1 red: 2 pink: 1 white

0 red: 4 pink: 0 white would be the phenotypic ratio expected in the o spring of two pink flowers. So, the correct option is (D).

What is Phenotypic ratio?

Phenotypic ratio defined as the relative number of offspring expressing a particular trait or combination of traits, which can be determined by performing a test cross and the frequency of the trait or trait combinations being expressed depending on the genotype of the offspring can be identified.

Phenotypic ratio is expressed as the ratio of different phenotypes present in the progeny of a cross where the ratios are numerical comparisons. For example, if one has three mangoes and two oranges, the ratio of mangoes to oranges will be 3:2.

For above given information, if we cross RR which is white with R'R' which is red, we will get 4RR' offspring which are pink in color. then the ratio will be 0 red: 4 pink: 0 white.

Thus, 0 red: 4 pink: 0 white would be the phenotypic ratio expected in the o spring of two pink flowers. So, the correct option is (D).

Learn more about Phenotypic ratio, here:

https://brainly.com/question/11552649

#SPJ6

meaning of cell or cytology​

Answers

Answer:

the smallest structural and functional unit of an organism, typically microscopic and consisting of cytoplasm and a nucleus enclosed in a membrane.

Explanation:

Cell is the building blocks of life.

The San Andreas Fault marks the boundary between which two tectonic plates?

Answers

Answer:

The San Andreas Fault is the transform plate boundary where a thin sliver of western California, as part of the Pacific Plate, slides north-northwestward past the rest of North America

I need help on biotics and factors​

Answers

Answer:

Biotic creatures are living things, like animals, plants, and cells

abiotoc are the enviroment they live in like, forests, desserts and bodies of water

Explanation:

did this help?

Can someone plz help

Answers

The answer to your question is the first one
A. The passage of genetic instructions for one generation to the next

Which type of human population is characterized by the lag phase, being able to raise crops and domesticated animals, but having over farming methods that lead to soil eorion and food shortages?

Answers

Answer:

Rural population.

Explanation:

The rural population of humans is characterized by the lag phase because they are linked with farming of crops and domesticated animals. This population is responsible for the soil erosion and food shortages over the country because they are the producers of everything for the food industry. Due to farming methods, soil erosion occurs that leads to the depletion of nutritive part of the soil that causes less productivity of the crop and as a result food shortage occur.

Question 21 (1 point) Sustainable use is often defined as the use of natural resources at a rate that meets the needs of the present human population but which also allows future generations to use the resource to meet their needs. Which of these BEST illustrates the concept of sustainable use? A fishing trawler uses a large net to catch a school of small fish A logging company reseeds and replants in a forested area after cutting down trees for timber Crops are rotated in a farmer's field to maximize grain yields Coal is mined using underground tunnels to avoid the destruction of surface soils by strip mining

Answers

Answer:

A logging company reseeds and replants in a forested area after cutting down trees for timber

Explanation:

Answer:

Sustainability is the capacity to endure in a relatively ongoing way across various domains of life.[1] In the 21st century, it refers generally to the capacity for Earth's biosphere and human civilization to co-exist. It is also defined as the process of people maintaining change in a homeostasis-balanced environment, in which the exploitation of resources, the direction of investments, the orientation of technological development, and institutional change are all in harmony and enhance both current and future potential to meet human needs and aspirations.[2][failed verification] For many in the field, sustainability is defined through the following interconnected domains or pillars: environmental, economic and social,[3] which according to Fritjof Capra,[4] is based on the principles of systems thinking. Sub-domains of sustainable development have been considered also: cultural, technological and political.[5][6] According to Our Common Future, sustainable development is defined as development that "meets the needs of the present without compromising the ability of future generations to meet their own needs."[7][8] Sustainable development may be the organizing principle of sustainability, yet others may view the two terms as paradoxical (seeing development as inherently unsustainable).[9]

Explanation:

PLEASE HELP 5TH GRADE SCIENCEEEE AHHHHHHHHH PLEASE HELP ME IM GONNA FAIL IF I DONT GET THIS Alanna spots a bird in her back yard. The bird is sitting on a tree. Explain how the outer coverings of the bird and tree are different and have different functions.

Answers

Answer:

The purpose of the outer covering of the bird helps keep it warm and to help it fly, whilst the outer cover of the tree is to protect it from bugs. 

Explanation:

Answer: Bird: helps protect it from the environment. Tree: To help reduce water loss.

Explanation:

The outer covering of the bird helps protect it from cold weather, while the outer covering of the tree helps it to reduce water loss.

Please give it a 5 star!

Other Questions
which of the following MOST influenced Tut's early decisions as ruler?(A)his own ideas about Egypt(B)his wife Ankhesenamun's advicehis religious belief in monotheism(D)his advisers Ay and Horemheb 3. Which level of government makes the furthest-reaching economic decision? What is the answer to this problem? Express the following as a single fraction in its simplest form: 12/y x y/3x Compare 1.41___1.397= What is the main purpose of this article? a. To inform people of precautions to take against the plague c. To talk about cures for the plague b. To inform people about a historically important plague d. To tell how friars dealt with the plague. If the exterior angles measurements of a hexagon are: 28, 45, 63, 57 and 81, findthe measure of the sixth exterior angle. 50 POINTSGizmos Moles Activity - chemistrycan someone please help me out PLS HELPPPP!!!!!! I GIVE BRAINLEST Mary lease was ___who spoke out in favor of banking and railroad reform?-an alliance leader-a grange leader Simba found some fascinating objects on his camping trip. He picked up several eagle feathers and a rattlesnake skin near his tent.a)Cause and Effectb)Examplec)Sequence Ans: 720cm2The ratio of the number of Malay students to the number of Indian students to thenumber of Chinese students in a school is 5:4:8.There are a total of 468 Indian and Chinese students.What is the total number of students?Ans: What quantity could go into the blank to make the equation a true statement? 5a + a + ___ = 10a Which of the following information would be most useful in determining whether 2 species are closely related? A) There leg bones look very similarB) The age of their bones, determined by carbon dating, is the sameC) The dna sequence found in their bones varies by only a few genesD) The bones were found in the same layer rock Valley forge: would do you have quit? Q: how could this document be used to argue for quitting Our atmosphere is composed of several gases. The name of the gas we breathe, O2, is A) oxygen squared B) monoxide. C) oxide. D) diatomic oxygen. Try These out and Ill give you brainliest no links posted on My question or I will report you In this portion of the U.S. Constitution, which branch ofthe government checks the power of which other branchof government by a two-thirds agreement? 7.10; 7.1F)4. The diagram below shows a triangle.15 in.12 in.6 in.A student drew a similar triangle usinga scale factor of The perimeter ofthe student's triangle wasA 11 in.29 in.B 22 in.D 33 in. Pls help asap thx19.