Answer:
it moves when carbon moves from fossil fuels to the atmosphere when fuels are burned when humans burn fossil fuels to power things and then most of the carbon quickly enter the atmosphere as carbon dioxide gas.
Explanation:
Which of the following statements explains why viruses are considered non-living?
Question 2 options:
A)viruses are too small.
B)Some viruses have RNA for genetic material instead of DNA.
C)Viruses have no nucleus to contain their genetic material.
D)Viruses require a host cell in order to reproduce.
A. 25%
B. 50%
C. 75%
D. 100%
Answer:
A
Explanation:
Because there 4squares and theres 1 recessive, recessive are represented with lowercase
Which of the following delivers oxygen to the body?
Mark all that apply
Arteries
Veins
Capillaries
Hemoglobin
BRAINLIEST!!!
What cells are used after injecting a vaccine that help us to not get sick?
Answer:
answer should be antibodies!
Explanation:
hope this helps <3
All living organisms are composed of what?
All living organisms are composed of one or more cells.So, your answer would be Cell.
hope it helps!
PLS HELP ME!!!!!!!!!!!
Answer:
From the mouse
Explanation:
It is directly gaining energy from the mous because the mouse is what gives the snake energy and if the snake directly consume it, it will get energy from it.
1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.
Answer:
Explanation:
BY USING FOREST WISELY;
It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;
1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.
2) Those trees of the world make up of portion land species by more than forth or fifth portion.
There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as
hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth
Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.
COMMUNITY CONSERVATION;
It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.
These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.
There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as
Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.
The article 'By using Forest Wisely' can be summarised as:
People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem. The trees produce oxygen and they made up at least a quarter of the world population.The trees occupy the fourth or fifth portion of the land organisms.In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die. The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available. Trees are required for manufacturing important materials.The article 'Community Conservation' can be summarised as:
In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating. The humans occupied the space to practice farming and make houses. The population of the gorillas was disturbed and diminished. The hunting of gorillas by poachers was also reduced. The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife. Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.
To know more about forest conservation, refer to the following link:
https://brainly.com/question/16505239
Please help out! It would be very nice !!
Answer:D
Explanation:
Cell wall provides structure and protection
Answer:
D is the answer to the question
Explain why DNA is called a molecular clock.
The molecular clock is a figurative term for a technique that uses the mutation rate of biomolecules to deduce the time in prehistory when two or more life forms diverged. The biomolecular data used for such calculations are usually nucleotide sequences for DNA or amino acid sequences for proteins.
Explanation:
A multicellular organism typically begins as a single cell, and then many cell divisions occur to generate the cells of the adult organism. However, these cells are not identical to the original cell, and they are not identical to one another.
What is the most significant cause of cell differentiation in a multicellular organism?
A.
differences in the number of chromosomes per cell
B.
differences in the genetic code used by different cells
C.
differences in the DNA that is copied and distributed among the cells
D.
differences in gene regulation and gene expression among the cells
Answer:
D
Explanation:
Difference in cell regulation and cell expression. This is embedded in chromosomes which is the blue print of the organism. The chromosomes is like the house plan when you building a house.
The most significant cause of cell differentiation in a multicellular organism is: D. differences in gene regulation and gene expression among the cells.
What is cell differentiation?Cell differentiation can be defined as a process through which a young, unspecialized cell undergoes various changes in gene expression, so as to become a specialized that is more specific in terms of function.
In a multicellular organism, which is an organism with multiple cells, the most significant cause of cell differentiation is as a result of differences in gene regulation and gene expression among its cells.
Read more on cell differentiation here: https://brainly.com/question/13846411
What kind of virus is corona virus?
Answer: It's an air borne virus resulting in SARS-CoV-2.
Answer:
its a flue
Explanation:
corona sucks
The landform pictured above is _____, which has formed out of _____ and _____.
O A. a glacier, snow; ice
B. a glacier; ocean water, snow
O C. a mountain; snow; ice
OD. an iceberg; ocean water, snow
Answer: a glacier; snow; ice
Explanation:
Just did it and it was right
Which action would be completed by skeletal muscle tissue 1.moving blood
2.increasing the heartbeat, or 3. kicking a soccer ball
Answer:
Kicking a soccer ball
Explanation:
Answer:
Kicking a soccer ball
Explanation:because moving blood and having a heartbeat arent in need of a skeletal system
Which chamber pumps blood to the lungs?
Answer:
The left atrium pumps blood into the lungs!
Explanation:
Biogeochemical cycles _______.
Answer:a biogeochemical cycle or substance turnover or cycling of substances is a pathway by which a chemical substance moves through biotic (biosphere) and abiotic (lithosphere, atmosphere, and hydrosphere) compartments of Earth.
Explanation:
. Why is the carpel considered female and the stamen male?
Answer: A carpel is the female reproductive part of the flower, interpreted as modified leaves that bear structures called ovules, inside which the egg cells ultimately form and composed of ovary, style and stigma. Stamen, the male reproductive part of a flower, consisting of a long slender stalk and the pollen-producing anther.
Explanation:
DNA is a molecule that stores____information in the cells
Answer: instructions
Explanation: trust me
Answer:
genetic
Explanation:
How many chromosomes does an organism get from EACH
parent?
egg and sperm cells have 23 chromosomes EACH
The mom would give 23
And the dad would give 23
23 + 23
46
Which of the following accurately describes one part of the hierarchy of organization in living systems?
A : Tissues are made up of various cell types.
B : Organs are made of of various organ systems.
C : Cells are made of various organs.
D : Tissues are made up of various organisms.
Answer:
A : Tissues are made up of various cell types
Explanation:
B : can't be correct because a system is made of many things, so an organ system is made of many organs. As such, it doesn't make sense for organ systems to make up organs.
C : can't be correct because cells make tissues, and tissues make organs, so cells can't be made of organs
D : can't be correct because an organism is the whole living being. Organisms are made of organs, and organs are made of tissues, so tissues can't be made of organisms.
That just leaves A!
Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG
Answer: DNA
Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.
RNA has all of those except for adenine which is replaced with Uracil.
What percentage of Japan’s population is between the ages of 0–4 years?
Answer:
looks like about 8% to me
40 to 44 percent of people are in the range of 0 to 4 years.
What is the population?A population is a group of different people. There are three different types of population such as rapid growth, slow growth, and negative growth.
In rapid growth, the population will grow rapidly. While slow growth population grows very slowly. In negative growth population growth is negative.
In the population graph, male and female growth is shown. The darker color in the population shows males and the lighter color shows females population.
Therefore, 40 to 44 percent of people are in the range of 0 to 4 years.
To learn more about the population, refer to the link:
https://brainly.com/question/27991860
#SPJ2
Sara's mother gets a flat tire on her car while driving Sara to school. They use a jack to
change the flat tire. It exerts a force of 5,000 newtons to lift the car 0.25 meters. How much
work is done by the jack? Use commas as appropriate.
Answer:
1250Joules
Explanation:
The parameters given are:
Force=5,000N
Distance= 0.25m
Work done by the Jack=
force×distance
= 5,000×0.25
=1250joules
Therefore, the Workdone by the Jack is 1250Joules
Which organisms create all usable food energy on Earth?
consumers
decomposers
heterotrophs
producers
Answer:
Hey!
Your answer is C.PRODUCERS!
Explanation:
These such organisms *such as the Apple Tree* are able to produce food via many alternative sources like from the energy of the Sun, C02, water and minerals that they absorb from the ground through the roots...
This energy is usable as an energy source!
HOPE THIS HELPS!!
b. Why is it possible to move the object that way?
Answer: Because force gives an object energy to move in a certain direction. The distance that object travels all depends on the amount of force used and the amount of friction the object intakes.
Why is the nitrogen cycle important for the survival of organisms in an ecosystem? A. The nitrogen cycle recycles nitrogen through an ecosystem, making it available to all organisms. B. The nitrogen cycle keeps organisms from consuming nitrogen in their ecosystem. C. The nitrogen cycle allows all organisms in an ecosystem to consume nitrogen instead of consuming each other. D. The nitrogen cycle stores nitrogen in safe places, keeping it from entering an ecosystem.
Answer:
The answer is A.
Explanation:
Nitrogen is an essential nutrient for plants and a significant component of proteins, which all animals need to grow, reproduce and survive. The nitrogen cycle converts nitrogen into compounds that plants and animals can use.
Answer:
A. The nitrogen cycle recycles nitrogen through an ecosystem, making it available to all organisms.
Explanation:
Nitrogen is a vital nutrient in ecosystems. The point of the nitrogen cycle is to recycle it so that it keeps being put back into an ecosystem.
For instance, animals need nitrogen in their diets. They get nitrogen by eating plants which obtain nitrogen from the soil. But how does nitrogen get into the soil? Well, decomposers can decompose dead organisms and recycle their nitrogen so that it enters the soil again. If there wasn't a nitrogen cycle, all the nitrogen would eventually be used up and ecosystems would suffer.
Please help me, thank you!
Gene: is a unit of heredity which is transferred from a parent to offspring and is held to determine some characteristic of the offspring. An example is hair or eye color
Allele: is different forms of a gene. An example would be how tall or short.
Homozygous: is two alleles that are the same trait. An example would be two alleles for straight hair.
Heterozygous: is two different traits like one for staright and one for curly hair.
Dominant: is the stronger form of an allele. Like the grey fur is the stronger one
Recessive: is the weaker form of an allele. Like white hair is the least likely.
Pheneotype: is the physical apperance.
Genotype is the genetic makeup of an organism.
A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?
A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left
Answer:
Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30
F=ma.
30=30a
a=30/30
a=1m/s^2
Drag each description to the correct type of succession.
vacant parking lot for many years
Primary succession
Secondary succession
abandoned baseball field
recently cooled lava field
rocky hill under a melted glacier
clear-cut forest
1) Intro
Done
ivity
Answer:
1) vacant parking lot for many years (secondary succession)
2) abandoned baseball field (secondary succession)
3) recently cooled lava field (primary succession)
4) rocky hill under a melted glacier (primary succession)
5) clear-cut forest (secondary succession)
Explanation:
Succession in ecology is the gradual encroachment of life on a given ecosystem.
Primary succession involve a new never-before colonized region like a new lava deposit or land hidden under glacial sheets. Secondary succession is the encroachment of life on an area formerly harboring life but had experience a disturbance like wildfire, agricultural activities, logging etc.
Answer:
PRIMARY SUCCESSION (recently cooled lava field) and (rocky hill under a melted glacier). SECONDARY SUCCESSION (vacant parking lot for many years) (abandoned baseball field) and (clear-cut forest.
Explanation:
it's correct
Define kinetic energy.
Tracey was learning about structural organization in animals. What level of structural
organization BEST describes an egg?
A. a cell
B. a tissue
C. a system
D. an organ
Answer:
A
Explanation:
Egg cell
The level of structural organization which best describes an egg is: A. a cell.
A cell can be defined as the fundamental (basic) structural, functional, and smallest unit of life, that is typically found in all living organisms such as animals.
The structure of an egg is similar to those of cells found in living organism, which are structurally layered with various cell organelles.
An egg shell is selectively permeable because it acts as an outer membrane just like in living cells to prevent unwanted materials from going into the egg.
In conclusion, the level of structural organization in animals cells can best be describe by using an egg.
Read more: https://brainly.com/question/19559847