how do you call the collection of organisms that belong to different populations but all live in the same area and interact with one another ​

Answers

Answer 1

Answer:

Ecosystem

Explanation:

Ecosystem is the amount of variation shown by organisms in an ecosystem.


Related Questions

50 POINTS

How can the environment impact a particular population of a species?

Answers

Answer:

Certain species need different environments to live in and if its too cold for one species it can lead to death of the population of that species.

that is what I put

Explanation:

What is the difference between chromosomes, chromatids, and homologous chromosomes?

Answers

Answer:

Sister chromatids are a pair of chromosomes inherited from each parent, while homologous chromosomes are the two parts of a chromosome.

Explanation:

Answer:

Chromosome- form of DNA when it divides

Chromatids- 2 identical chromosomes attatched at a centromere

Homologous- 2 chromosomes with the same structure

Explanation:

Hope this help

sample 1
sample 2
sample 3
sample 4

Answers

Answer:

Sample 1

Explanation:

Dna contains carbon, hydrogen, oxygen, nitrogen, and phosphorus. These make up the sugar-phosphate backbone of the DNA also known as the sides of the ladder.

Multiple Answer
Which of these is evidence for evolution?
a caterpillar changing into a butterfly
a tadpole changing into a frog
horse teeth becoming flatter over time in the fossil record
mutations in DNA
a chicken egg hatching
c. vestigial rear leg bones in whales
different shapes on Galapagos tortoises from different islands
a tailbone in humans
similar bone structure in whale flipper and human hand

Answers

Caterpillar
Tadpole
Chicken

Think about the meaning of these words fruit seed germinate cotyledons, embryo ,plumule ,dormancy,root hairs. Write a sentence containing each of these words

Answers

Answer:

When a seed, taken from a fruit, is planted and watered under the correct temperature, it breaks dormancy, and the embryo germinates; first, the root grows covered by root hairs, then the cotyledons appear, and finally, the plumule elongates to reach the light.

Explanation:

Fruit: It forms by the mature ovary of the flowers. This structure contains and protects the seeds in its interior. Its principal function is to transport seeds to a distant area away from the parental plant and let the new plant emerge under the correct environmental conditions. The fruit develops different strategies to accomplish its function. Seed: Refers to the fecundated and mature ovule. This structure is the typical dissemination and dispersion unit of spermatophyte plants. Seeds are formed of three tissues. An embryo. A seminal tegument that covers and encloses the latent embryo. And the endosperm -a nutritious tissue-. Seeds develop and grow under the protection of the fruit body. Embryo: It is formed after fecundation. It composes of growing cotyledons, an epicotyl, and a hypocotyl. The tegument and endosperm of the seed protect the embryo from dehydration and denutrition. Once the seed is in the correct place, the embryo grows and emerges. Cotyledon: The two first leaves of the embryo. They have reserve nutritive tissues to help the embryo grow. It also performs photosynthesis. The embryo usually develops one or two cotyledons and one radicule or root hair. Plumule: First shoot of the young emerging plant. When the embryo is growing, it elongates to reach more sunlight. Root hairs: Extention of the roots´ cells that look like hairs and whose principal function is to absorb nutrients and water from the ground. They can be found in the maturation area of the root. Germination: Process of development and the emergence of the embryo. These are a series of steps that must occur in the seed from the moment the embryo begins to develop until a newly emerged plantule is formed. For germination to occur, there must be the appropriate environmental conditions. Dormancy: Period in which an alive seed can not germinate because there is a condition inside the seed that does not allow germination to occur yet. The seed is in dormancy, but it keeps viability.  

Cellular differentiation progressively restricts cell fate because the unexpressed genes in the cell:Select all that apply become more densely packed with nucleosomes accumulate both point mutations and deletions accumulate point mutations undergo irreversible repression accumulate deletions.

Answers

Answer:

undergo irreversible repression

Explanation:

Cellular differentiation refers to the process by which one cell and/or cell population divides and differentiates into more specialized cells. During cell fate differentiation, epigenetic marks modify chromatin structure in order to hamper the accessibility of the transcriptional machinery and transcriptional factors to different genes, which are irreversibly repressed. These epigenetic marks include DNA methylation and histone modifications (e.g., histone acetylation, histone methylation, etc). For example, it has been shown that DNA methylation and histone H3 lysine 27 tri‐methylation (H3K27me3) are epigenetic repressive marks on genomic regions that play a major role in gene expression programs during cell fate differentiation.

True or false glucose is the primary nutrient for all living things

Answers

Answer:

true

Explanation:

glucose is the primary nutrient for all living things

Answer: True

Why? The primary source of energy for animals is carbohydrates, primarily glucose: the body's fuel. The digestible carbohydrates in an animal's diet are converted to glucose molecules and into energy through a series of catabolic chemical reactions.

Hope this helps :D

how does the body's organization enable it to function

Answers

Answer:

All of the body's internal organs and systems rely on each other to function in harmony and this is what enables the body to function

Explanation:

define ammonotelism?​

Answers

Answer:

The process where certain organisms excrete nitrogenous waste in the form of ammonia is known as Ammonotelism.

Explanation:

Ammonotelism is the process of excretion of ammonia and ammonium ions. Such animals are called ammonotelic.

What would happen within a few months if all decomposers on Earth disappeared overnight?
There would be an overabundance of organic waste.
Plants would grow out of control.
Animals would grow out of control.
There would be no visible impact.

Answers

Answer:

There would be an overabundance of organic waste.

Explanation:

I took the same test :)

functions of ribosomes and lysosomes​

Answers

Answer:

Ribosomes are responsible for making proteins

Lysosomes are responsible for removing wastes, as well as destroying a cell after it dies

Answer:

functions of ribosomes and lysosomes :-

ribosomes -

- they are many in number.

-they are not membrane bound.

-they are responsible for protein synthesis. the more the amount of protein synthesised, more the number of ribosomes.

- they are either attached to endoplasmic reticulum or they will be freely present inside the cytoplasm.

lysosomes -

- they contain digestive enzymes that break down waste materials, foreign material and cellular debris. they are capable of digesting fats,proteins, etc. along with them lysosomes also digest or damage their own cells by their own enzymes, which lead to death of the cells. this process is called as autolysis. hence, tysosomes are also called suicidal bags.

Answer the question help me please I'll mark as brainiest

Answers

Answer:

The human male and female reproductive cycles are controlled by the interaction of hormones from the hypothalamus and anterior pituitary with hormones from reproductive tissues and organs. In both sexes, the hypothalamus monitors and causes the release of hormones from the pituitary gland.

How does this behavior affect the survival of the eagle population?

Someone please help:)

Answers

Answer:

A. Provides a safe place for offspring to grow

Explanation:

Answer:

A

Explanation:

I took the test recently

Select the activities in which crop estimates play a critical role.


develop sampling pattern

plan harvest and storage requirements

estimate necessary soil inputs

obtain delivery estimates

budget for cash flow

obtain organic certification

obtain crop insurance

organize recommended timing

Answers

based on my opinion :

1, 3, 5, 6, 7

If a mosquito has 6 chromosomes in each body cell how many chromosomes will each new body cell have after mitosis?

Answers

Answer:

After mitosis, the daughter cells will have the same number of chromosomes as the parent cell, so 6 chromosomes

Mushrooms, bread molds, and yeasts are classified in the fungi kingdom Specific characteristics are used to classify these organisms. Why are these organisms in the fungi kingdom and not in the animal kingdom?
O They are parasites that feed off a host organism.
O They contain only one cell.
O They absorb nutrients directly from the environment.
They are prokaryotes

Answers

Answer:

C

Explanation:

They absorb nutrients directly from the environment.

What are Prokaryotes?

A prokaryote is a single-celled creature without a nucleus and other membrane-bound organelles he Greek words pro and v (pro, meaning "before") are combined to form the word prokaryote. 

Prokaryotes were categorized under the empire Prokaryota in the two-empire system developed by Édouard Chatton. However, prokaryotes are split into two domains in the three-domain concept, based on molecular analysis:

Bacteria (formerly Eubacteria) and Archaea (previously Archaebacteria). The third domain, Eukaryota, is designated for organisms containing nuclei. Prokaryotes are thought to have evolved before eukaryotes in terms of biology.

Therefore, They absorb nutrients directly from the environment.

To learn more about prokaryotes, refer to the link:

https://brainly.com/question/15329345

#SPJ2

What is the best reason that producers are the most numerous group in an ecosystem?

A. Producers produce food energy for themselves and all the other levels

B. There is more room for small organisms than there is for large ones.

C. As energy flows through the ecosystem some anergy is added at each step.

D. Soil and temperature conditions is an ecosystem always favor producers.

Answers

Answer:

A.) Producers produce food energy for themselves and all the other levels

Hope this helps!

Answer:

A is the answer taking the test right now

hope you have a great day

halimiocistus plant reproduce sexually or asexually? Is their organism identical or similar?​

Answers

Answer:

They produce both sexually and asexually. Also the organism is similar

Explanation:

I learned this last year

5. Which is the complimentary DNA strand of the DNA strand:
ATGCATGCAATG * (T
(8 Points)
ATGCATGCAATG
TACGTACGTTAC
UACGUACGUUAC
TAGCATGCTTAC
None of the above

Answers

Answer:

TACGTACGTTAC (so the second one)

Which one is the true answer

Answers

Carlos is correct, because sedimentary rock form under a lot of pressure

How is natural selection similar to selective breeding? How is natural selection different from selective breeding?

Answers

Answer:

Natural selection and selective breeding can both cause changes in animals and plants.the difference between the two is that natural selection happens naturally, but selective breeding only occurs when humans intervene. for this reason selective breeding is sometimes called artificial selection.

Explanation:

Hope this helped Mark BRAINLEST!!!

Explain why the last image would be an Apocalypse

No LINKS if u don't know it DOn'T ANSWER IT.

Answers

Because the moon is very close to the earth. If the sun was between the moon and the earth the earth would burn up

The leaves of plants have many specialized structures. Which statement explains the importance of the stomata and guard cells for the plant?
o They protect the plant from pests
o They are involved in plant reproduction
They work together to regulate water loss and gas exchange.
o They regulate the amount of water that enters the plant for cellular respiration

Answers

Answer:

They work together to regulate water loss and gas exchange.

They work together to regulate the loss of water and exchange of gases.

Stomata and guard cells

The tiny pores or openings in plant tissue, which allow for the exchange of gases are known as stomata.

The unique cells, which surround stomata and work to close and open the stomatal pores are known as guard cells.

Both these helps a plant to take in carbon dioxide at the time of photosynthesis and also assist in reducing the loss of water by getting closed when conditions are dry and hot.

Thus, stomata and guard cells work together to regulate the loss of water and gas exchange.

Find out more information about stomata and guard cells here:

https://brainly.com/question/7602098

how does overpopulation affect anaerobic respiration?

Answers

Answer:

I really don't think over population can affect humans anaerobic respiration

I’m assuming you’re starting from an aerobic environment. The overpopulated bacteria would use up all the air and start to go through anaerobic respiration. It’s just not desired because they wouldn’t be able to get as much energy out of their food source as they’d be able to by using oxygen.

If you’re in an anaerobic environment, I’m not sure if it would affect it at all.

Compare the composition of Nucleic acids to lipids

Answers

The smooth endoplasmic reticulum also processes these lipids, which store energy.

Nucleic Acids: Carry genetic information or form structures within cells. Carbohydrates: storage and transport of energy and structural components.

Proteins: Many proteins are enzymes that catalyze biochemical reactions, and are vital to metabolism.

Which of the following correctly describes the cell cycle?
A: Event in the normal life cycle of a cell

B:Events in the normal life cycle of a human

C:Event that change DNA

Answers

Answer:

A: Event in the normal life cycle of a cell

Do mutations in body cells contribute to genetic variation?(1 point)

A) No, the causes of body cell mutations are outside the body and cannot alter DNA.

B) Yes, the mutations can be passed on to offspring and contribute to variation in the population.

C) Yes, these body cell mutations lead to mutations in the gametes.

D) No, the mutations cannot be passed to offspring and only affect the individual.

Answers

A mutation is the alteration of the genetic sequence of an organism, which can either be inherited or cannot be inherited. The mutation when transmitted to the offspring leads to genetic variation.

The correct answer is:

Option B. Yes, the mutations can be passed on to offspring and contribute to variation in the population.

Mutation is the change in the genetic sequence of the organism, which can be caused due to environmental factors and can be inherited.

The mutations can lead to genetic disorders, chromosomal disorders, or any other conditions. The mutations like a disease or adaptation that can be passed onto the offspring can result in genetic variation.

The mutation leads to genetic diversity, as the mutation is also the first step towards evolution. The organisms better suited to the environment will survive more and adapt more. These changes in the organisms will be inherited by the offspring leading to genetic variation.

Therefore Option B is correct.

To know more about mutation, refer to the following link:

https://brainly.com/question/4222118

Which organelle is considered the control center of the cell or the "brain" of the cell? It contains all the DNA or the instructions to carry out the function of the cell??

Answers

Answer:

The nucleus

Explanation:

The nucleus of eukaryotic cells is the "control center". It contains DNA which tells the cell how to function.

Please mark Brainliest!  

HELP I NEED HELP ASAP
HELP I NEED HELP ASAP
HELP I NEED HELP ASAP
HELP I NEED HELP ASAP

The main disadvantage of using solar energy to generate electricity is that solar panels

A. Produce greenhouse gases
B. Produce water pollution
C. Are expensive to operate
D. Are expensive to purchase

Answers

I believe the answer is D, are expensive to purchase.

Answer:

D - cost of purchasing

Explanation:

Solar panels use the sun to operate which has no cost so the answer is not C

The sun does not create green house gases and has nothing to do with pollution so the answers can't be a or b leaving us with answer choice D

PLSS HELP!!

What type of succession starts with some soil but then goes through the 10p
steps of succession?

A. Primary Succession
B. Secondary Succession
C. Climax Community

Answers

Explanation:

Ecological succession is the process of change in the species structure of an ecological community over time. The time scale can be decades (for example, after a wildfire), or even millions of years after a mass extinction.[1]

Succession after disturbance: a boreal forest one year (left) and two years (right) after a wildfire.

The community begins with relatively few pioneering plants and animals and develops through increasing complexity until it becomes stable or self-perpetuating as a climax community. The "engine" of succession, the cause of ecosystem change, is the impact of established organisms upon their own environments. A consequence of living is the sometimes subtle and sometimes overt alteration of one's own environment.[2]

It is a phenomenon or process by which an ecological community undergoes more or less orderly and predictable changes following a disturbance or the initial colonization of a new habitat. Succession may be initiated either by formation of new, unoccupied habitat, such as from a lava flow or a severe landslide, or by some form of disturbance of a community, such as from a fire, severe windthrow, or logging. Succession that begins in new habitats, uninfluenced by pre-existing communities is called primary succession, whereas succession that follows disruption of a pre-existing community is called secondary succession.

Succession was among the first theories advanced in ecology. Ecological succession was first documented in the Indiana Dunes of Northwest Indiana and remains at the core of much ecological science.[3]

Other Questions
3+4-8+9-8+78+99-7999+8799+06997+90797883+677_5= May someone help me with this :) Describing Work ActivitiesNote that common tasks are listed toward the top and less common tasks are listed toward the bottom.According to O*NET, a pharmacy technician should be able to use computers to enter, access or retrieve data to adhere to safety procedures and use the metric system.What Work Activities are being described? Check all that apply.a. processing informationb. getting informationc. interacting with computersd. evaluating information to determine compliance with standardse. identifying objects, actions and eventsf. updating and using relevant knowledge 13. Given the original DNA strand, which of the following would be the new, complementary strandof DNA? ACTTACGCCGAT *(8 Points)CAGGCATAATCGACTTACGCCGATTCAATCGCCGTATGAATGCGGCTA Can someone please help me fix the errors?Please don't answer if you don't know Arrange the following steps to explain the process of protein synthesis inside the eukaryotic cell. Help please! 50 points! Troll answers WILL be reported Describe how each of thefollowing are evidence for Continental Drift1. Fossils2. Landforms3. Rock Formations4. Climate what is 3/4x2/3a.5/12b. 6/12c.5/7d. 6/7 How to not go to jail for j walking (HELP ASAP)Select the graph which best represents this scenario:The amount of pancake batter that you must mix increaseswith the number of people who come to breakfast. It takes3 cups of batter to serve 10 people.(More context in the picture) What is not a type of text format that will automatically be converted by Outlook into a hyperlink?O email addressO web addressO UNC pathO All will be automatically converted. Cup G has a diameter of 4 in. and a height of 8 in. Find the volume of Cup G. James is twice as old as Hannah. Four years from now, the sum of their ages will be 41. How old are they now? (24^0)+(4^0). solve this problem fast Class A misdemeanor, based on the federal level, has a maximum fine of which of the following? Where dose the earliest known Indian literature come from Eva has a coupon for an oil change with synthetic oil for $59.95. She can buy 5 quarts of synthetic oil, which is what her car needs, for $26.54 and an oil filter for $6.47. How much can she save by doing the oil change herself?$79.22$139.17$59.95$32.92$26.94 which element is shown in the picture here? What is the sum of the two polynomials?