A white blood cell (WBC) encounters bacteria in a scrape on the knee of a child who has fallen off of his bicycle. The WBC’s job is to take the bacteria inside of itself and destroy the bacteria. If the bacteria cannot be moved across the WBC membrane, how will the WBC most likely take it in?
Answer:
The correct answer is - phagocytosis.
Explanation:
Phagocytosis is a type of endocytosis that also engulfs the solid material including microbial pathogens like bacteria and others. In immunity response macrophages, neutrophils and. immature dendritic cells are white blood cells that perform the phagocytosis process to kill the microbes and antigens.
Phagocytosis ingests and digest pathogens and develops an adaptive immune response an essential part of the innate immune system. WBC will most likely take it in through phagocytosis in the given case.
Name the main hormone that causes the tropic response movement of pollen tubes towards ovule.
Answer:
Chemotropism
Explanation:
Which of the following is not a true statement of the lungs?
Answer: The right lung is shorter and wider than the left lung, and the left lung occupies a smaller volume than the right.
The lung houses structures of both the conducting and respiratory zones.
The left lung consists of three lobes.
The lungs exchange respiratory gases across a very large epithelial surface area—about 70 square meters
Explanation:
1. Indicate patient history details that are consistent with the patient having an infection. How do the patient’s signs and symptoms compare to a healthy individual?
2. Indicate what you suspect might be the etiological agent. What additional history would you like to have?
3. Based on the microbe you suspect is responsible for the symptoms, from which body sites would you recommend taking culture?
4. . Give culture and test characteristics of the microbe you suspect might be causing the disease. If you suspect more than one might be responsible, how might you distinguish the two?
5. Indicate virulence factors possessed by this microbe that might be responsible for the symptoms. Indicate how it produces the symptoms you observe in the patient.
6. Is this microbe normal microbiota at the culture site?
7. What type of treatment would be used for this patient
Answer:
All the answers are there in the photo
Why was the Battle of Bunker Hill important in the war for American independence from Britain? A. The battle was the first important victory for the fledgling Continental Army. B. The battle was the first important victory for General George Washington. C. Although the British ultimately won the battle, they lost their best general. D. Although the British ultimately won the battle, they suffered heavy casualties.
Answer: D. Although the British ultimately won the battle, they suffered heavy casualties.
Explanation: Even though they lost, the colonial forces were able to inflict a substantial amount of damage resulting in lots of casualties.
which statement is true of both mitosis and meiosis?
A) The number of
chromosomes is reduced by half.
B) both occur only in reproductive cells.
C) DNA replication occurs before the division of the nucleus.
D) both are involved in asexual reproduction.
Answer:
The statement 'b. both occur only in reproductive cells' is true
What could a human living now and a dinosuar living millions of years ago have in common?
help now pls im desperate
Answer:
We both drank the same water, due to the water cycle
Or you can say: We both breathed the same air
Explanation:
If the number of births and deaths in a given time are equal, then the population size will be stable. True or False?
Answer:
True
Explanation:
Because for each death someone is born
It's like 1+1+1-1-1=1
The answer is the same
Biology
what is carbohydrates
Answer:
Simple carbohydrates are broken down quickly by the body to be used as energy. Simple carbohydrates are found naturally in foods such as fruits, milk, and milk products. They are also found in processed and refined sugars such as candy, table sugar, syrups, and soft drinks.
If a horse sheds there coats in the spring and summer to allow for easier cooling during warm weather.
Is it Stimuli or Homeostasis?
Answer:
hi l have a question
Explanation:
can you help me
I’ll Venmo u 5 dollars if u help me. I have a human made for of pollution and natural form of pollution. I have to pick which one is human and natural
During a storm, heavy rain ___________ a large rock into smaller pieces and then those pieces are __________ downstream from one place to another. *
erodes / weather
deposits / eroded
weathered / eroded
discharges / deposits
Answer:
1) erodes
2)deposits
Explanation:
How does your model support the claim that
the Northern and Southern Hemispheres
have different seasons?
Answer:
Due to presence on opposite side of the globe.
Explanation:
My model support the claim that the Northern and Southern Hemispheres have different seasons due to present on different location on the globe. The seasons in the Northern Hemisphere are different and opposite of those in the Southern Hemisphere. Seasons occur because Earth is tilted on its axis. This tilting causes summer in one location whereas winter in other location. The Earth's tilt causes the Southern Hemisphere to lean towards the Sun during summer season of Southern Hemisphere while on the other hand, it is winter season in the Northern Hemisphere which leans away from the Sun.
Is there anything we as a society can do to prevent these pandemic from occurring
The only thing you can do now is to try do the necessary pre-causion, which are;
Always wear maskAlways be sanitizedAlways wear hand glovesKeep social distancingPlz do 10 and 14❤️❤️❤️❤️
Answer:
no
Explanation:
Which of the following describes the products of mitosis?
two unique cells
one cell identical to the parent
cell death
two daughter cells that have identical DNA to the parent
Answer:
The products of mitosis are two diploid cells, whereas the products of meiosis are four haploid cells. -Mitosis and meiosis both begin with duplicated chromosomes. -In mitosis the daughter cells are genetically identical, but in meiosis the daughter cells are genetically varied.
Explanation:
In cellular respiration, glucose molecules are split into _____ and______atoms.
O hydrogen and oxygen
O sulfur and lithium
O glucose and fructose
O carbon and nitrogen
In cellular respiration, glucose molecules are split into _____ and______atoms.
☑ hydrogen and oxygen
O sulfur and lithium
O glucose and fructose
O carbon and nitrogen
Because glucoses consistuents are H,C,O so most possibly opt 1 is correct.
Answer:
aExplanation:
in cellular respiration, glucose molecules are split into hydrogen and oxygen atoms just as sofia has said.
Have a nice day ! :-)
ALL of the following are applicable only
in the United States EXCEPT
A. Clean Water Act
B. Safe Drinking Water Act
C. Marine Protection, Research, and Sanctuaries Act
D. London Convention on the Prevention of Marine
Pollution
Answer:
the answer is C. Marine protection, research and sanctuaries Act.
Which process is characterized by the movement of particles from an area of high concentration to an area of low concentration across the plasma membrane without the use of energy?
1) hypertonic transport
2) active transport
3) passive transport
4) dynamic equilibrium
Answer:
3) passive transport
Explanation:
Passive transport is a type of cellular transport that does not require the use of energy to move substances (i.e., ions and molecules) across biological membranes. Passive transport uses concentration gradients to move substances across cell membranes, thereby transporting them from regions of high concentration to regions of low concentration. Passive transport can be divided into 1-osmosis (i.e., movement of solvents), 2-diffusion (i.e., movement of solutes), and 3-facilitated diffusion (i.e., movement of molecules with help of protein channels or carriers), and 4-filtration (i.e., movement of water by using a pressure gradient).
Answer: moves particles from on area of low concentration to an area of high concentration
Explanation: Active transport differs from passive transport because active transport
can only move particles into the cell.
does not require energy to transport particles.
moves particles from an area of low concentration to an area of high concentration.
depends on the random movements of particles to carry them across the membrane.
EDG2023
Describe how the complete oxidation of 1 mole of glucose can generate 32 ATPs. You should include i) products of anaerobic glycolysis with numbers, ii) products of Krebs cycles with numbers, and iii) process of ATP synthesis by electron transport chain via NADH/FADH and H ions
Answer:
Explanation:
1.During glycolysis,four molecules of ATP are formed,and two are expended to cause the initial phosphorylation of glucose to get the process going.This gives a net gain of two molecules of ATP
For every glucose molecule that undergoes cellular respiration, the citric acid cycle is carried out twice; this is because glycolysis (the first stage of aerobic respiration) produces two pyruvate molecules per glucose molecule. During pyruvate oxidation (the second stage of aerobic respiration), each pyruvate molecule is converted into one molecule of acetyl-CoA—the input into the citric acid cycle. Therefore, for every glucose molecule, two acetyl-CoA molecules are produced. Each of the two acetyl-CoA molecules goes once through the citric acid cycle.
The citric acid cycle begins with the fusion of acetyl-CoA and oxaloacetate to form citric acid. For each acetyl-CoA molecule, the products of the citric acid cycle are two carbon dioxide molecules, three NADH molecules, one FADH2 molecule, and one GTP/ATP molecule. Therefore, for every glucose molecule (which generates two acetyl-CoA molecules), the citric acid cycle yields four carbon dioxide molecules, six NADH molecules, two FADH2 molecules, and two GTP/ATP molecules. The citric acid cycle also regenerates oxaloacetate, the molecule that starts the cycle.
While the ATP yield of the citric acid cycle is modest, the generation of coenzymes NADH and FADH2 is critical for ATP production in the final stage of cellular respiration, oxidative phosphorylation. These coenzymes act as electron carriers and donate their electrons to the electron transport chain, ultimately driving the production of most of the ATP produced by cellular respiration.
Need help answering this question, check the picture
Answer:
A single replacement reaction occurs when an element reacts with a compound to produce a new element and a new compound. It can only occur when the element that is doing the replacing is more reactive than the element that is being replaced. Therefore, it is useful to have a list of elements in order of their relative reactivities. The activity series is a list of elements in decreasing the order of reactivity. Since metals replace other metals, while nonmetals replace other nonmetals, they each have a separate activity series.
There are two types of single replacement reactions:
A metal replaces another metal that is in solution:
A + BC → B + AC
Example: Zn + CuC[tex]l_{2}[/tex] → Cu + ZnC
A halogen replaces another halogen that is in solution:
A + BC → C + BA
Example: Br[tex]_{2}[/tex] + 2KI → I
How does water help drive the rock cycle?
A. It is abundant on Earth's surface.
B. It is an agent of weathering and erosion.
C. It helps Earth maintain a relatively constant temperature.
D. It maintains a liquid state in a relatively narrow range of temperatures
ap3x
Which is a compound?
Answer:
A thing that is composed of two or more separate elements; a mixture is called compound.
g Two linked genes, (A) and (B), are separated by 18 centiMorgans. A man with genotype Aa Bb marries a woman who is aa bb. The man's father was AA BB. What is the probability that their first child will both be ab/ab
Answer:
The probability that their first child will both be ab/ab = 41%.
Explanation:
Available data:
Two linked genes (A) and (B) ⇒ 18 centiMorgans apartMan ⇒ Aa BbMan´s father ⇒ AA BBWoman ⇒ aabbThe recombination frequency is given by the distance between genes. We have to know that 1% of recombinations = 1 map unit = 1cm.
Recombination frequency = 0.18
Man: AaBb
Gametes) AB Parental
ab Parental
Ab Recombinant
aB recombinant
18 centi morgan = 18 % of recombination in total
= % aB + % Ab
= 9% aB + 9% Ab
100% - 18% = 82% of parental in total
= % of AB + % ab
= 41% AB + 41% ab
The frequency for each gamete is:
AB 41%
ab 41%
Ab 9%
aB 9%
Cross: man x woman
Parental) AaBb x aabb
Gametes) AB, Ab, aB, ab ab, ab, ab, ab
Punnett square) AB ( 41%) Ab (9%) aB (9%) ab (41%)
ab AaBb Aabb aaBb aabb
ab AaBb Aabb aaBb aabb
ab AaBb Aabb aaBb aabb
ab AaBb Aabb aaBb aabb
F1) 41% of the progeny is expected to be AaBb
9% of the progeny is expected to be Aabb
9% of the progeny is expected to be aaBb
41% of the progeny is expected to be aabb
Which statement correctly compares mass and weight?
A.Both depend on the force of gravity pulling on an object B.The basic unit of both is the kilogram C.Both mass and weight ofan object would be less on the moon than on Earth D.Weight varies with location, but mass does not vary
Answer:
D. Weight varies with location, but mass does not vary
Explanation:
Weight can be defined as the force acting on a body or an object as a result of gravity.
Mathematically, the weight of an object is given by the formula;
[tex] Weight = mg [/tex]
Where;
m is the mass of the object.g is the acceleration due to gravity.Mass can be defined as a measure of the amount of matter an object or a body comprises of. The standard unit of measurement of the mass of an object or a body is kilograms.
Irrespective of the location of an object or a body at a given moment in time, the mass (amount of matter that they're made up of) is constant. This ultimately implies that, whether you're in the moon, space, earth or any other place, your mass remains the same (constant).
Hence, the statement that correctly compares mass and weight is that, weight varies with location, but mass does not vary. This is simply because acceleration due to gravity changes with location i.e its value varies with the planets.
What is flight initiation distance FID
Answer:
Fight initiation distance (FID) is the distance at which an animal will start to move away from an approaching threat such as a trail user.
hope this helps<3
During Meiosis, an important event occurs where the chromosomes that you inherited from your mom exchange pieces with the chromosomes you inherited from your dad. This process is called:
a. Genetic Exchange
b. Recombination
c. Synapsis
d. Crossing Over
Answer:
Hi, there your answer is D.Crossing Over
Hope This Helps
PLZ CORRECT ME IF I AM WRONG :)
Explanation:
Which is NOT a passive transport mechanism across the membrane of a plant cell?
Which is NOT a passive transport mechanism across the membrane of a plant cell?
Facilitated diffusion
Diffusion
Osmosis
Receptor-mediated endocytosis
Answer:
the company has also announced plans
que es la educación,.......
Answer:
el proceso de recibir o dar instrucción sistemática, especialmente en una escuela o universidad.
Explanation:
espero que esto ayude!
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read
Answer:
Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.
Codons before mutation: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.
Explanation:
Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.
The Sequence before mutation ATGCTGCGAAACTTTGGCTGA
Codons: ATG CTG CGA AAC TTT GGC TGA
The Sequence after mutation ATGTGCGAAACTTTGGCTGA
Codons: ATG TGC GAA ACT TTG GCT
Only the first one (ATG) might coincide with one of the codons before mutation.