Hormones are chemical molecules produced by endocrine glandsOne such endocrine gland is the thyroid gland, synthesizes the thormone, which in tur the heart musclesWhich statements describe the probable reason for the function of the hormone role

Answers

Answer 1

Answer:

Topic Overview. The thyroid gland uses iodine from food to make two thyroid hormones: triiodothyronine (T3) and thyroxine (T4). It also stores these thyroid hormones and releases them as they are needed.

Explanation:

Topic Overview. The thyroid gland uses iodine from food to make two thyroid hormones: triiodothyronine (T3) and thyroxine (T4). It also stores these thyroid hormones and releases them as they are needed.


Related Questions

Why does all mammals have seven vertebrae (bones) in their neck?

A) all mammals descended from a common ancestor
B) predators only eat animals with six neck vertebrae
C) all animals can turn their heads the same amount
D) all mammals have to stretch their necks to obtain food

Answers

Answer:

C I hope I'm right........

..............

It has to do with evolution.
A. All mammals descended from a common ancestor.
* Descending from a common ancestor has to do with evolution.

The spider in the diagram above has _____________ gene versions for the bristle feature.

Answers

Answer:

3400

Explanation:

Answer:

i

Explanation:

a major disadvantage of solar power is that sun doesnt shine in one place 24 hours a day from this we can infer that

Answers

Answer:

you

Explanation:

Gas exchange occurs by the process of .

Answers

Answer: Basic Principles of Gas Exchange

Gas exchange during respiration occurs primarily through diffusion. Diffusion is a process in which transport is driven by a concentration gradient. Gas molecules move from a region of high concentration to a region of low concentration.

Explanation:

Gas Exchange with Tissues

Gas exchange occurs in the alveoli so that oxygen is loaded into the bloodstream and carbon dioxide is unloaded from the bloodstream. ... Oxygen diffuses into the cells of the tissues, while carbon dioxide diffuses out of the cells of the tissues and into the bloodstream.

Hope it helps

Answer:

diffusion

Explanation: Diffusion is defined as the migration of a chemical from a high-concentration area to a low-concentration area. Diffusion occurs in liquids and gases when particles migrate randomly from one location to another. Diffusion is the mechanism through which chemicals flow into and out of cells in living things.

Salad vegetables are cut and placed in plain water. Why?

Answers

Answer:

Not only does soaking produce rid it of harmful germs or chemicals, but it can also be used to revitalize produce for a better taste and longer life. If you purchase local, organic fruits and vegetables that contain no chemicals or harmful preservatives, you can use warm water to rinse your produce.

Explanation:

Fun facts:

Through osmosis, water naturally moves from areas of low salt concentrations to areas of high salt concentrations. ... Consequently, the water in a leaf of lettuce that is soaking in salt water will migrate out of the lettuce leaving a mushy leaf behind.

Adaptions natural selection and evolution

Answers

Answer:

it's either A or D

Explanation:

but I think it's A

Which of the following would NOT
help restore your gut
microbiome?
A. supplements
B. yogurt with active cultures
C. medicine
D. allowing it to fix itself

Answers

Answer:

I believe the awnsner is medicine. ((Not completely sure))

Explanation:

I think so because medicine is usually used to help defeat a sickness and not as much as repairing something that's wrong.

The answer choice which would not help restore one's gut microbiome is; Choice D; allowing it to fix itself.

What is a microbiome?

A microbiome simply refers to community of microorganisms such as bacteria, fungi, vuruses which exist in a given habitat or specific environment.Some microbiomes such as bacteria regulate our immune system, Helps to produce vitamins such as thiamin, riboflavin, niacin or nicotinic acid, cyanocobalamin. etc and ultimately, helps to digest food easily.

On this note, the choice which would not help restore one's gut microbiome is allowing it to fix itself.

Learn more about microorganisms:

https://brainly.com/question/17434674

Meiosis plays a more significant role in reproduction than mitosis in which of the
following ways?

Answers

Answer:

A

Explanation:

the first one is the answer

What is the current to the following DNA strand TATTAGATTACA

Answers

Answer:

ATAATCTAATGA

Explanation:

Nucleic acid sequence of bases that can form a double- stranded structure by matching base pairs. DNA has four nucleobases: adenine, thymine, guanine, and cytosine. The nucleobases in a DNA strand have preferred partners to form hydrogen bonds with. Cytosine pairs with guanine, and adenine pairs with thymine. These are the base pairing rules that allow DNA replication and protein synthesis to happen.

What is Anaerobic Respiration?

a. process of producing energy with oxygen
b. process of producing energy without oxygen.

pls help

Answers

Answer:

it is the process of producing energy without oxygen

What must the pea and lettuce plants take up through their roots to perfum photosynthesis

Answers

Answer: The pea and lettuce plants are leguminous plants.

Explanation:

The pea and lettuce plants must take nitrogen from the soil which they get after the symbiotic association with the nitrogen fixing bacteria. Nitrate and ammonia are the two components of nitrogen that can be taken from the soil and used as a source of nitrogen. Nitrogen is required for the growth of plant and it is the important component of chlorophyll pigment. Chlorophyll pigment is necessary for the process of photosynthesis in which the chlorophyll pigment traps sunlight energy that is involved in the splitting of molecule of water into hydrogen and oxygen.

chromosomes_____ select all that apply
-always occur in pairs
-are tight coils of dna
-can be analyzed in a karyotype
-carry thousands of genes
-are carried on genes

Answers

Answer:

Are al

Explanation:

todos forman parte de las características de los cromosomas. Recuerde también que los cromosomas se encuentran en las células, específicamente en su núcleo.

easy biology question below first correct answer gets brainliest

Answers

Answer:

25% of the offspring

If {T} is dominant and {t} is recessive, then only offspring with two {t} are short. Dominant genes overpower recessive genes unless BOTH genes are recessive.

Predict the type of relationship between the ant and the ant-lion.
A. Commensalistic

B. Mutualistic

C. Predator-Prey

D. Parasitic

Answers

Answer:

C. Predator-Prey

Explanation:

There are predator-prey relationship between ants and antlions.

The type of relationship between the ant and ant lion is Predator-Prey. The correct option is C.

What is predator-prey relationship?

Predator-prey relationship implies to the interactions among the two species where one species is the killed food resource for the another one.

The organism that feeds is referred to as the predator while the organism that is fed upon is basically the prey. There are mainly most variety of illustrations of predator-prey relations.

Competition as well as predation are ecological interactions but are not symbiotic.

Predation usually does not take place over a long period of time, along with the competition is an indirect interaction on other resources.

Predation is a symbiotic interaction in which one species sustains life on costuming the another species.

The species that win is the predator, and the species that is lost up is the prey.

Thus, the correct option is C.

For more details regarding predator-prey relationship, visit:

https://brainly.com/question/1778577

#SPJ2

What kind of bonds holds together atoms within a molecule

Answers

Answer:

covalent bonds

Explanation:

The bonds that hold atoms together to form molecules are called covalent bonds. They are pretty tough and not easily made or broken apart. It takes energy to make the bonds and energy is released when the bonds are broken.

hope this helps!

mark brainiest/ add me if you can<3

Answer:

The bonds that hold atoms together to form molecules are called covalent bonds. They are pretty tough and not easily made or broken apart. It takes energy to make the bonds and energy is released when the bonds are broken

Explanation:

Have a nice day :)

Do plants and animals use cellular respiration to generate energy?
A. Yes

B. No

Answers

Answer:

yes

Explanation:

This cellular respiration is carried out by every cell in both plants and animals and is essential for daily living. Cells use glucose and oxygen to produce yg p carbon dioxide, water, and energy. In cellular respiration, the carbohydrates from food are disassembled into glucose molecules.

Plants undergo cellular respiration.

Animals don't need to photosynthesize since they get their glucose from the food they eat. Cellular respiration is not simply the same as "breathing." This can be confusing! People often use the word "respiration" to refer to the process of inhaling and exhaling.

Answer:

A. Yes

Explanation:

Yeah, the plants and animals use cellular respiration to generate energy. So, option (A) is correct answer.

Hi can someone help me

Answers

Answer:

loss of food causes rabbits to die which will lesson the population

Explanation:

Answer:

The rabbit may die due to lack of food

Too much rabbits means less food

True or False: The most fertile agricultural land in North America is used to produce mostly wheat and corn.

Answers

True

I looked up the most fertile land in the US (Great plain region)

Then I looked at a crop map

Looks like it’s mostly wheat and corn grown in the Great Plains

Hope this helps.

The word equations show two different types of respiration that can happen in yeast.

X: glucose + oxygen carbon dioxide +_____

Y: glucose carbon dioxide +_____

Please give 1 answer.
A.
x - water
y- ethanol

B.
X-ethanol
y- water

C.
none

Answers

Answer:

X - water

Y - ethanol

Explanation:

glucose turns into ethanol due to anaerobic respiration in the yeast enzymes.

How is mitosis different in plants and animals?

Answers

Answer:

tyzhdtyhzftgh

Explanation:

xftghszertryh

Answer:

Explanation:

The most important and observable difference in the plant animal cells mitosis is the cytokinesis. In plants a new cell plate is formed between the daughter cells for the future cell wall, while in animal cells the cell membrane constricts to separates the parent cell into daughter cells.

How long after their discovery did it take the scientific community to accept the existence of cells?
15 years
1 year
150 years
50 years

Answers

The answer is 150 years

what are the different ways to recycle biodegradable waste?​

Answers

Answer: Composition maybe?

Explanation:

Penecillin is a bacterium.
True
False

Answers

Answer: False

Explanation:

Answer:

False

Explanation:

They are antibiotics to fight off bacterial infections.

Industries produce approximately
what percent of solid waste in the
United States?
A. 10%
B. 25%
C. 30%
D. 50%

Answers

Answer: 50 percent would be about how much they produce.

50%, it goes up way more but 50% is the most highest

A plant experiences a mutation to its xylem tissue. The plant will no longer To transport

Answers

Answer:

The plant will no longer be able to transport water and dissolved minerals from the roots to the rest of the plant

Please Help.

What is the name of the process that plants use to remove carbon dioxide from the atmosphere?

1.) transpiration
2.) photosynthesis
3.) respiration
4.) decomposition

Answers

Photosynthesis is the answer

What invertebrates only live in salt water?

sponges

echinoderms

mollusks

cnidaria

Answers

Answer:

echinoderms

Explanation:

echinoderms are a group of aquatic invertebrates but they are only found in salt water

Answer:

Sponges

Explanation:

They can only live in salt water

Which statement best describes the function of the human body system

Answers

Answer:

the human body consists of several body systems including  integumentary system, skeletal system, muscular system, lymphatic system, respiratory system, digestive system, nervous system, endocrine system, cardiovascular system, urinary system, and reproductive system and the skelital system (please specify which one)

Explanation:

Answer:

Body System                                                                                Primary Function

Cardiovascular/Circulatory                                                      Blood circulation

Digestive                                                                               Processing food

Endocrine                                                                       Hormone production

Urinary                                                                                   Waste elimination


How are bone and cartilage similar?
a. they are both rigid.
b. they both act as shock absorbers
c. they both contain living cells
d. they both produce red blood cells

Answers

Answer:

c they both contain living cells

12. Flowers whose reproductive structures consist only
of stamens would be able to produce
A) fruits with seeds
B) fruits without seeds
C) pollen
D) ovules

Answers

Answer:

Pollen reproductive structures consist only

of stamens would be able to produce

Explanation:

No C is the answer

Reproductive structures are structures that make up the reproductive organs of a particular organism. These structures could include either female or the male reproductive organs.

Flowers with reproductive structures that comprise of only stamen would produce only pollen (option c).

Stamens are reproductive organs found in plants and they are male reproductive organs. For fruits with seeds to be formed the male and female reproductive organs must come together to produce a fruit.

Flowers with only the stamen will produce only pollen which is a male gamete that needs to be joined to the female gamete, ovary produced from the female reproductive structure (pistil) in a plant to produce a fruit.

Learn more: https://brainly.com/question/23140508

Other Questions
Which of the following equations correctly represents the distance between points (1, -1) and (-2, 2)? Rewrite the sentence to eliminate ambiguous, remote, or broad reference.If a person has income tax questions, the IRS can help you with it. The two general types of air pollution are _____ and _____.invisibleparticlesgasesliquid How many square tiles large is the surfce area of lake huron than the surface area than the surfce area of lake Erie Glycolysis takes place in _________________. The cytoplasm The mitochondrial intermembrane space The mitochondrial matrix The endoplasmic reticulum Which sentence correctly uses a comma to join independent clauses? The real numbers whose decimals do not end and do not repeat are (irrational numbers / rational numbers). Answer this guys please I would really appreciate if someone could answer this :) What is the degree of 1 Which detail is most important to include in a summary? Electric current is the flow of ________ through a substance. A shopper is visiting an outdoors market and finds a rug to buy. The shopper does not have a measuring tape to measure the rug. Instead, the shopper takes steps across the rug to determine the dimensions. The shopper's shoes are approximately 12 niches long. What is the estimated area f the rug? Read the excerpt from a report. (1) Stopping trash before it gets to the ocean is way better than having to clean it up in the ocean. (2) The city of Baltimore has a large machine called Mr. Trash Wheel. (3) The machine is powered by the sun and the flow of the river. (4) Floating booms off the front of the machine funnel garbage toward a conveyor belt. (5) The belt takes the garbage from the water and puts it in a dumpster. (6) The trash wheel helps collect garbage in the river after it flows out into the ocean.Which revision improves the professional tone of the text?Change sentence 1 to: Preventing garbage from entering the ocean is more effective than removing waste from the sea.Change sentence 2 to: The city of Baltimore has really cool machine called Mr. Trash Wheel.Change sentence 4 to: Floating booms and a conveyor belt help the machine work its magic.Change sentence 5 to: The belt takes a bunch of the garbage from the water and then tosses it in a dumpster. Please helpExplain two audiences groups that the movie is sustainable for a bank robbery movie? explain in two different paragraphs. 5 to the power -2 * 5x is equal to 1 solve for x If he jumps from the plane with a velocity of +2 ft/s and, after 7 seconds of free fall, he has a velocity of -223ft/s, what is his displacement? Albino Moth - Unknown Allell is listed here. Transcribe it into mRNA andthen translate it into amino acids using the codon table. You only need topost the amino acids. DNA - TGG GGT AAG GAC GAG CGC ATC CAGAGPheUUUUUC)UUAUUGCysUGUUGCUGAUAUUAC)TyUAAStopSerLeuStopUGGTrpUCUUCCUCAUCGCCUCCACCGUAG)CAUTCAC)CUUCUCCUACUGHisLeuProCGUCGCCGACGGArgCAACAG)AAUGinlleSerAUUAUCAUAAUGACUACCACAACGThrAAC) AsnAGUAGC)AGAAGG)Met 13GAUArgGUUGUCValGCUGCCGCAGCGAlaGAC} AspGGUGGCGGAGGGGlyGUAGAAGAGGluGUG If two opposing forces are equal, then the net force is 0 N.true or false? Which is a quadratic function?A y = X-9B y = x +9C y = x + 2x -9