hi ok pls help me 78/90 divided by - 68/190

Answers

Answer 1

Answer:

-0.00006707946

Step-by-step explanation:

I just looked up the equation and this came up on a calculator. Next time just look it up on google. :) Have a nice night


Related Questions

Nii saved more than Yaw. He saved 17 cedis more than Yaw

Answers

Answer:

thats great =)

Step-by-step explanation: can i pls have brainliest pls im on one more

Answer:

Step-by-step explanation:

uhh

The solution to a system of equations is (5,-19) choose two equations that might make up the system
A. y=-3x-6
B. y=2x-23
C. y=-7x+16
D. y=x-17
E. y=-2x-9

Answers

Answer:

E

Step-by-step explanation:

By definition,

Linear equation

Linear or first degree equations are of the type ax + b = y, with a≠0, or any other equation in which when operating, transposing terms and simplifying they adopt that expression.

A solution to an equation is a number that can be entered into the variable to make a true number statement.

This case

In this case, you know that the solution to a system of equations is (5,-19). This is, x=5 and y=-19.

Replacing the value of x in linear expressions, I can calculate the value of y and I must get that y=-19.

A. y=-3×5 -6 → y= -15 -6 → y= -21

B. y=2×5 -23 → y= 10-23 → y= -13

C. y=-7×5+16 → y= -35 +16 → y= -19

D. y=5-17 → y= -12

E. y=-2×5-9 → y= -10 -9 → y= -19

Observing the solutions obtained, the equations that satisfy the solution and make uo the system are option C. and E.

Learn more about system of equations:

https://brainly.com/question/13997560

https://brainly.com/question/1836777

https://brainly.com/question/1995493

https://brainly.com/question/7487907?referrer=searchResults

What is the rate
$150/25
written as a unit rate?
A.

$30/5
B.

$6/1


C.

$4/1
D.

$125/2

Answers

The answer is B, divide the rate by the unit to simplify

Answer:

B

Step-by-step explan

150 divide by 25

25 divide by 25

what is 3,910 divided by 25 using the power of 10
A: 25
B: 250
C: 25,000

Answers

Answer:

izuocha is superior

Step-by-step explanation:

Answer:

ochaochaochaocha

Step-by-step explanation:

sorry i trying to get attention from someone

One brand of cookies is sold in three different box sizes small medium and large the small box has half the volume of the Box the volume of the medium box the volume of the medium boxes X if someone buys one of each size which expression shows the combined volume of the three boxes?

Answers

Answer:

 3.5x

Step-by-step explanation:

the medium box would be 1x, if small is half the size, its 0.5x, and large is 2x since its 2x the size of medium. add all of them up and its 3.5x size

At the start of the month, Stephen’s savings account had a balance of $1,624. He made a $420 withdrawal each week for four weeks. During that month, he also made two deposits of $600 each and one deposit of $1,000. What was the balance in Stephen’s account at the end of the month?

Answers

Answer:

- 1625

Step-by-step explanation:

420 times 4 = 1680

1624 - 1680 = -56

-56 - 600 - 1000 = -1625

BRAINLIEST PLEASE

There are three choices of jelly beans: sour apple, cherry, and blue
raspberry. The probability of getting a cherry is 1/4, blue raspberry is 2/5,
what is the probability of getting sour apple?

Answers

Answer:

7/20

Step-by-step explanation:

Total probability=1

Total probability of selecting either cherry or raspberry=¼+²/5=13/20

Probability of getting sour apple=1-13/20=7/20

find the value of x.
4.
122°
100°
to
144

Answers

Answer:

84 degrees i think

Step-by-step explanation:

polygons have their interior angles add up to 540, so you just add up all the angles given and subtract them from 540, then you get your answer.

Elena deposits $1,500 in a savings account that earns 3.0% simple interest per year. If no deposits or withdrawals are made during the year, how much money will be in her account after one year?

Answers

Answer:

FV= $1,545

Step-by-step explanation:

Giving the following information:

Elena deposits $1,500 in a savings account that earns 3.0% simple interest per year.

To calculate the nominal value of the account after one year, we need to use the following formula:

FV= (P*r*t) + P

FV= future value

P= principal

r= interest rate

t= 1

FV= (1,500*0.03*1) + 1,500

FV= $1,545

A video game awards points each time a player finds a diamond. The players' point total increases with each additional diamond the player finds, as shown in the table below.

If n represents the number of diamonds found and p represents the total number of points, write an equation that models the points awarded for finding diamonds in this video game. Use the on-screen keyboard to type the equation in the box.

Answers

Answer:

15x-5=y

Step-by-step explanation:

The equation of the line will be written as y = 15x - 5.

What is an equation of the line?

An equation of the line is defined as a linear equation having a degree of one. The equation of the line contains two variables x and y. And the third parameter is the slope of the line which represents the elevation of the line.

The general form of the equation of the line:-

y = mx + c

m = slope

c = y-intercept

Slope = ( y₂ - y₁ ) / ( x₂ - x₁ )

The given data is,

The number of diamonds          Total number of points earned

      1                                                             10    

      2                                                            25

      3                                                            40    

      4                                                            55  

      5                                                            70

The slope of the line will be,

Slope = ( 25 - 10 ) / 1

Slope = 15

The y-intercept of the line,

y = mx + c

y = 15x + c

10 = 15 + c

c = -5

The equation will be written as,

y = mx + c

y = 15x - 5

Therefore, the equation of the line will be written as y = 15x - 5.

To know more about an equation of the line follow

https://brainly.com/question/18831322

#SPJ2

Sas a ribbon that is 5/6 yard long. She cuts off 3/5 of that ribbon and uses it to tie her hair back. She gives the rest to her sister. How much of the original ribbon did she give to her sister? ​

Answers

Answer:

7/30

Step-by-step explanation:

5/6 = 25/30  3/5 = 18/30

25/30 - 18/30 = 7/30

Sas gives 7/30 of the ribbon to her sister.

Hope this helps! :3

Help me pls ASAP thank you

Answers

Answer:

3rd option

Step-by-step explanation:

The input(x) does not repeat

answer quickly !!! Pls

Answers

Answer:

(6 × 5) + (6 × 3) = 6 × (5 + 3)

Step-by-step explanation:

Since both 5 and 3 are being multiplied by 6, the total would be 6 multiplied by the sum of 5 and 3.

PLEASE HELP

due today in 20 minutes
i will mark you brainliest

Answers

Excuse if I have this wrong but I’m going to guess that in every question how the 2 is up the m or the other letters that means you are multiplying that number/ letter by its self one more time so I’m not really sure, I’m sorry.

find the solution to the following system using substitution or elimination:
y = 3x + 2
y = -2x - 8
A. (-2, -4).
B. (-3/5, -34/5).
C. (-6/5, -8/5).
D. (1, 6)

Answers

Answer: A

Explanation:

Just use substitution because it's more efficient. Plug -2x-8 into y to make -2x-8=3x+2. Add 8 to both sides to get -2x=3x+10. Subtract 3x to both sides to get -5x=10. Divide -5 to both sides to get x=-2. Now, plug in x=-2 to one of the equations, let's use y=3x+2. The equation would be y=3(-2)+2. Multiply 3 and -2 to get -6. Add -6 to 2 and you'll result with y=-4.

It should be A (-2,-4). When using elimination.

Solve the system using substitution. Check your solution.
2x - y= 65
5y = x

Answers

Answer:

The solutions to the system of equations are:

[tex]x=\frac{325}{9},\:y=\frac{65}{9}[/tex]

Step-by-step explanation:

Given the system of the equations

[tex]\begin{bmatrix}2x-y=65\\ 5y=x\end{bmatrix}[/tex]

isolate 'x' for 2x-y

[tex]2x-y=65[/tex]

Add y to both sides

[tex]2x-y+y=65+y[/tex]

[tex]2x=65+y[/tex]

Divide both sides by 2

[tex]\frac{2x}{2}=\frac{65}{2}+\frac{y}{2}[/tex]

[tex]x=\frac{65+y}{2}[/tex]

[tex]\mathrm{Subsititute\:}x=\frac{65+y}{2}[/tex]

isolate 'y' for  [tex]5y=\frac{65+y}{2}[/tex]

[tex]5y=\frac{65+y}{2}[/tex]

[tex]10y=65+y[/tex]

subtract y from both sides

[tex]10y-y=65+y-y[/tex]

[tex]9y=65[/tex]

Divide both sides by 9

[tex]\frac{9y}{9}=\frac{65}{9}[/tex]

[tex]y=\frac{65}{9}[/tex]

[tex]\mathrm{For\:}x=\frac{65+y}{2}[/tex]

[tex]\mathrm{Subsititute\:}y=\frac{65}{9}[/tex]

[tex]x=\frac{65+\frac{65}{9}}{2}[/tex]

[tex]x=\frac{325}{9}[/tex]

The solutions to the system of equations are:

[tex]x=\frac{325}{9},\:y=\frac{65}{9}[/tex]

helppppppansjfnnsnwkgn

Answers

Answer:

the third one P N M

Step-by-step explanation:

Answer:

NPM

Step-by-step explanation:

i got you fammmmmmmmm

Passing through
(1,2) and (5,10)

Answers

Step-by-step explanation:

equation of the line is

y =mX + C

to calculate m(slope) :

m= 10-2/5-1 = 2

to find C ....Substitute in eq. by one point

2= 2×1+C

C. = 0

So the eq. is

y=2X

Can anyone by chance know how to do these geometry questions?

Answers

my screen shows black pages there isn’t anything there for me?

Answer:

G is equal to (8, -11)

Step-by-step explanation:

We are given the midpoint and one end of the line segment.  We can find the other end of it by taking the distance from H to M, doubling it, and adding that to H:

[tex]G(x, y) = H(x, y) + 2(M(x, y) - H(x, y))\\\\G_x = H_x + 2(M_x - H_x)\\G_x = -4 + 2(-6 - (-4))\\G_x = -4 + 2(-2)\\G_x = -4 - 4\\G_x = 8\\\\G_y = H_y + 2(M_y - H_y)\\G_y= 3 + 2(- 3 - 4)\\G_y= 3 - 6 - 8\\G_y = -11[/tex]

So the coordinates of endpoint G are (8, -11)

Simplify 3(2y -1) + 2y

Answers

Answer: 8y -3

Step-by-step explanation:

3(2y -1) + 2y

6y -3 + 2y

8y -3

Answer:

8 y - 3

Step-by-step explanation - I got it from google so its right 100%

1. Suppose Alice eats 3 ounces of base 2 cake (doubles her height for each ounce eaten) at each meal. a) What will her height be multiplied by after two meals? b) After three meals? c) After four meals? d) After M meals?

Answers

Answer:

a)64

b)512

c)2^12

d)2^3m

Step-by-step explanation:

At every meal, 3 ounces of the cake is eaten

a) After 2 meals, the number of ounces consumed is 6 ounces

For each ounce, height is doubled , for 6 ounces, we have 2 * 2 * 2 * 2 * 2 * 2

Her height is multiplied by 64

b) After three meals

Total consumption is 3 * 3 = 9 ounces

So her height will be multiplied by 2^9 = 512

c) After four meals

Total ounces is 4 * 3 = 12

So her height will be multiplied by 2^12

d) After M meals

Number of ounces is m * 3 = 3m ounces

Her height will be multiplied by 2^3m

What is the y-intercept of the equation?

Answers

Answer:

5

Step-by-step explanation:

Y=-3x+5

the y-intercept would be 5

please help me i’ve tried so many of these and i can’t figure out how to do it

Answers

Answer:

15.4%

Step-by-step explanation:

Calculate the volume of both containers.

The volume (V) of a cylinder is calculated as

V = πr²h ( r is the radius and h the height )

[tex]V_{A}[/tex] = π × 10² × 11 = 1100π ft³

[tex]V_{B}[/tex] = π × 7² × 19 = 931π ft³

Subtract volume of B from volume of A to find quantity left in A

quantity left in A = 1100π - 931π = 169π ft³

To calculate the percentage left in A after B has been filled

[tex]\frac{left}{full}[/tex] × 100%

= [tex]\frac{169\pi }{1100\pi }[/tex] × 100%

= [tex]\frac{169}{1100}[/tex] × 100%

= 15.4% ( to the nearest tenth )

PLEASE HELP ME WITH THIS ASAP

Answers

9514 1404 393

Explanation:

1. ΔABC ≅ ΔDEF . . . . . 1. SAS postulate*

_____

The two given congruent sides are either side of the given congruent angle, so the SAS postulate applies. The objective appears to be irrelevant.

The equation 2x-7=5+x has exactly one solution. True or false

Answers

Answer:

True

Step-by-step explanation:

x=5+7=12

The only solution is x=12.

BRAINLIEST!! Can someone help me with the following problem?


(- 2*10+2)/3 +14*2-5+9=y

Solve for "y" :)

Answers

I believe that the answer is 26 but I’m not completely sure
Have a nice day :)

Which expressions are equivalent to 5x?
(Didn’t expect the test to be this hard ;C)
A: 5x + 0
B: x (0) + 4x
C: x + (0 + 4x)
D: 4x + (1) x
E: 5x multiplied by 0
F: 5x (1)

Answers

Answer:

A, E, F

Step-by-step explanation:

Your welcome

Answer:

its a,d,c,e, and f

Step-by-step explanation:

I need help by score is going down

Answers

Answer:

JUST DO IT!

Step-by-step explanation:

Motivation

Find c.
3.3
450
450
с
Write your answer in simplest radical form.
units

Answers

Answer:

c = 3[tex]\sqrt{6}[/tex]

Step-by-step explanation:

triangle is right isosceles so both sides equal 3[tex]\sqrt{3}[/tex]

can use pythagorean theorem which is square each leg and set it equal to the hypotenuse (side 'c') squared

(3[tex]\sqrt{3}[/tex])^2 +  (3[tex]\sqrt{3}[/tex])^2 = c^2

(9x3) + (9x3) = c^2

27 + 27 = c^2

54 = c^2

c = [tex]\sqrt{54}[/tex]

simplify  [tex]\sqrt{54}[/tex] to equal = [tex]\sqrt{9}[/tex] x [tex]\sqrt{6}[/tex] which simplies to 3[tex]\sqrt{6}[/tex]

Someone help plz right answer gets to be brainliest

Answers

1) A
2)E
3)B
4)G

If you have any questions let me know:)
Other Questions
For another question, Nancy needs her to mark the numbers 1 1/3 and -1 1/3 on the number line. How many spaces does she need between 1 and 2, and between -1 and -2, so that she can mark 1 1/3 and -1 1/3? Fill in the blank with the Spanish word that best completes the following sentence.Cuando necesito dinero, hablo con _________. 5) In a urea manufacturing plan, all employees work a basic week of 40 hours. Ay overtime worked during weekdays is paid for at time-and-a-quarter. Overtime worked on Saturday is paid for at time-and-a-half, whilst on Sunday it is paid for at double time. If the basic rate is $14.60 per hour and a man worked 15 hours overtime during weekdays, 6 hours overtime PLEASE HELP ME!! I WILL MARK BRAINLIEST!! : How did the events in the reading establish Portugal as a major trading centre? What were some of the goods that the Portuguese traded? Were these different from those that the Italian merchants offered? What is inflation A. An increase in the supply of currency that reduces the currencys value B. A demand for more goods that can be met by production C. An increase in unemployment due to a serious recession D.an excess of goods that results in lower prices Multiple ChoiceWhich method adds an element at the beginning of a deque?appendleftO insertleftO popleftaddleft Which element is probably most like Carbon? and why GIVING BRAINLIEST!!!What were the major issues that prisoners faced in Andersonville prison? Select all that apply. (2 points)A. Water was scarce and polluted.B. Food supplies were inadequate so prisoners starved.C. Prisoners rebelled and staged an uprising.D Prison overcrowding forced prisoners to be freed early. What is the product of 417.2 x 0.64? simplify by combining like terms: 3 1/9p + 5 - 1/3p How would adding the catalyst nitrogen monoxide (NO) affect this reaction?2SO2(g) + O2(g) 2SO3(g)A) NO increases the rate at which SO3 molecules are formed.B) NO reacts with SO3 to produce more SO2 molecules.C) NO decreases collisions between the SO2 and O2 molecules.D) NO increases the concentration of the SO2 and O2 molecules.E) NO increases the activation energy of the SO2 and O2 molecules. thanks guys i only got one question wrong i cant find my answer. You should really give your people the answer they are looking fo instead of giving sujestions. Write the slope-intercept equation for the graph. Energy that is stored is called... Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC write a letter to your friend describing him/her about your country nepalGuys plz help me with this question write a letter about nepal. If u guys help me with this question i will make you brainliest and give 25 points. But its so urgent so plz do it fast. help child.......help me need help thank you very