help.................

Help.................

Answers

Answer 1

Answer:

I would say B.

de-forestation is definitely not the answer. and introducing non native species is usually a big no no for the ecosystem.

Answer 2

Answer:

b

Explanation:

if there is nothing to kill bees with then they wont die.


Related Questions

Earth science question. Please help

Answers

Answer:

answer choice 4, more rain and a steeper slope cause it to flow faster

Explanation:

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

help-- multiple choice!
Biogenic sediment is made of at least 30 percent...

acidic chemicals

alkaline properties

limestone or other rock

skeletal remains

Answers

Answer:

The answer is the last one, skeletal remains

Answer: Skeletal remains

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.

How can a person cannot taste PTC I'd both of their parents have the ability to taste PTC?

Answers

Answer:

the parents are (Tt) and each passed down the recessive allele so the child is  (tt)

Explanation:

What is the relationship between the rock cycle and the plate tectonics?

Answers

Answer: The metamorphic rocks can erode into sedimentary rocks which can turn into igneous rock. Metamorphic rocks in the rock cycle is driven by tectonic plates.

Explanation:

In protein synthesis, how many nitrogenous bases code for a single amino acid?
one
two
three
four

Answers

3 nitrogenous bases code a single amino acid.

Answer:

C

Explanation:

EDGE 2022

Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea

Answers

Answer:

Yes.

Explanation:

Yes, it is a good idea by sterilizing everything because this sterilization process kills bacteria or other harmful microbes on the items and no chance of bacterial infection occurs in the base that is present on the moon. This sterilization process is very important in order to make the health of the crew members and scientists that lives in the base on the moon. If the bacteria or other harmful microbes enters in the base so its maintained environment will triggers its growth and infections in the humans so it is a good idea.


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.

_____ Motor neurons cause muscles to contract so the body can react to the stimulus.

_____ The brain processes the information through interneurons.

_____ Interneurons transfer response information to motor neurons.

_____ Sensory neurons carry stimulus information to the brain or spinal cord.

Answers

Answer:

The correct answer is -

1 - The stimulus is received by sensory receptors.

2 -  Sensory neurons carry stimulus information to the brain or spinal cord.

3 -  The brain processes the information through interneurons.

4 -  Interneurons transfer response information to motor neurons.

5 - Motor neurons cause muscles to contract so the body can react to the stimulus.

Explanation:

In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.

These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.

PLEASE HELP I NEED HELP (Plant related / Project stuff)

Answers

Answer:

B, D, A, E, C

Explanation:

1. environmental factors

2. growth

3. adaptation

4. organism

5. genetic factors

dead cells are removed from the Dermis by phagocytosis. true or false?​

Answers

The answer to your question is false I think.

3 examples of radioactive dating?

Answers

Answer:

Uranium 238

Potassium 40

Rubidium 87

Explanation:

How is energy produced by respiration stored

Answers

Answer:

Explanation:

Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.

Answered by the ONE & Only #QUEEN aka  #DRIPPQUEENMO

Hope this helped!!!

true or false
Photosynthesis is part of an oak tree's niche.

Answers

Answer:

True, veryyyyy true

:))

How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars

Answers

Answer:

b

Explanation:

Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.

The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.  

Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:

DNA is the genetic material of the cell  DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formation  

Thus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.  

Learn more about DNA here:

https://brainly.com/question/264225

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

The energy that powers photosynthesis comes from
A. oxygen.

B. water.

C. the sun.

D. chemicals.

Answers

Answer:

sun but am not so sure about it

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

30. Which of the following best explains why enzymes are necessary for many cellular reactions?
A. Enzymes supply the oxygen necessary for the reactions.
B. Enzymes change reactants from solid to liquids during the reactions.
C. The reactions take up too much space in the cell if the enzymes are missing.
D. The reactions are too slow to meet the needs of the cell if enzymes are missing.

Answers

Answer:

D. The reaction are too slow to meet the needs of the cell if enzymes are missing

hope it helps

what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?

Answers

the answer is hematopoiesis

Thank you to anyone who answers .

Answers

Answer:

D

Explanation:

Answer:

i think its D but im so sorry if it wrong my second answer would probably be A

Explanation:

i really hope this helps sorry if it doesn't

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

Which of the following is a molecule with more than one element?
O Atom
O Bacteria
O Compound
Organism

Answers

Answer:

compound

Explanation:

as cited from coolgalapagos.com, "Molecules made of more than one kind of element are called compounds. A compound is formed when one kind of atom (an element) joins to at least one other kind of atom of a different element."

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

People who have leukemia, cancer that affects white blood cells, are often given Cytarabine. This drug inhibits the synthesis of DNA. Which phase of the cell cycle is most affected by Cytarabine?

Answers

Correct answer is S phase. cytosine into cytosine arabinoside triphosphate is what makes the answer S phase.

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:


Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera
Other Questions
Which overall chemical equation is obtained by combining these intermediate equations? Find the percent of the number. 25% of 50 is Is this relationship proportional or non proportional What did the Homestead Act declare (say)? Explain any issues people may have had with it? What are the traits or an organism called ? The midpoint of AB is M(-4, 2). If the coordinates of A are (-6, 5), what are the coordinates of B? What were the main ways that Americans moved west? what does FDR see as necessary to protect the nation and other keepers of democracy? A graphic designer creates a logo in the shape of an ellipse. The equation+64= 1, with units in centimeters,14.44represents the outer edge of the logo. How tall is the logo? An earlier study determined that 60% of women older than age 50 have annual mammograms. To see if this proportion is still valid, we send surveys to 1000 women older than age 50. Of the 100 who respond, 70 say they have annual mammograms. What is the (estimated) current proportion of women older than age 50 who say they get annual mammograms Speed and time play a major factor in:ScrimmageTactical movementSituation awarenessDrill Sides or angles with the same measure are congruent. True or false 60 points!!!!how did poor whites view the newly freed black people? Find the volume for each. A good topic for a persuasiveessay must be debatable,reasonable, andA. popular.B. have no strong opposite arguments thatmight threaten your position.C. have a reasonable, opposite position. What is the value of g^-1(1) Joel is mailing a large envelope to his cousin. The envelope has pictures inside, so he doesn't want to bend it. What is the maximum width for the mail slot??? Why might the U.S. face its own Luddite-style rebellion?AWorkers believe that they perform better work thanthe machines that have replaced them.BNew jobs for replaced workers do not pay as well asold, lost jobs.Innovation and invention have stopped increasingwealth in the U.S.DInnovation and increased wealth no longer ensurenew job markets for replaced workers. Will give brainliest:Im homeschooled but my classmate whos also virtual keeps texting me for answers to everything. I dont mind helping but am I wrong for not wanting to work together all the time with her? She asked did I want to work together on a test, I feel really bad and I dont know how to respond. She dont even cooperate, she just wait 2 hours and asks if I can send the answers . Help Please answer this for mePlease don't say that the answer is in a link