HELP PLEASE I WILL GIVE BRAINLIEST

HELP PLEASE I WILL GIVE BRAINLIEST

Answers

Answer 1

Explanation:

A is the correct answer in my opinion. Thanks.

Answer 2
I think A as well :)

Related Questions

Which of the following connects the right and left hemispheres of the brain, allowing communication between
the to?
Medulla Oblongata
Pons
Corpus Callosum
Brain Stem

Answers

Corpus callosum will be your answer

What process is typical of cancer? replacement of damaged cells DNA replication cellular death uncontrolled cell division

Answers

Answer:

Cancer is the uncontrolled growth of abnormal cells in the body. Cancer develops when the body's normal control mechanism stops working. Old cells do not die and instead grow out of control, forming new, abnormal cells.

Answer:

D.uncontrolled cell division

Explanation:

edg 2022

6. The three main regions of the brain that receive and process information are the cerebrum, the cerebellum, and the ____________________________.

Answers

The answer for the last region is : The brain stem

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answers

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

Need help, I will give branliest

Answers

Answer:

Supergiants

Explanation:

I NEED HELP ASAPPP PLEASE
C. When the arm extends (straightens), which muscle contracts?

Answers

Explanation:

When your biceps muscle in your upper arm contracts, it pulls your lower arm in towards your shoulder. However, when it relaxes, your biceps cannot push your arm back out. To do this, your triceps muscle, on the underside of your upper arm, contracts and straightens your arm out.

Answer:

When your biceps muscle in your higher arm contracts, it pulls your lower arm in to your shoulder. when it relaxes, your biceps cant push your arm back out.  and straightens your arm out.

Explanation:

of the following are abiotic factors in an ecosystem except _______.

Select one:

a.
types of minerals


b.
ocean currents


c.
types of bacteria


d.
temperature

Answers

c. types of bacteria

Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a difference in the structure of proteins and polysaccharides? *
A. forming a variety of gametes that will pass on hereditary information

B. disrupting meiosis and the synthesis of amino acids into a sequence

C. producing the inorganic molecules needed for normal cell growth

D. directing the synthesis of proteins necessary for proper cell function

Answers

D. directing the synthesis of proteins necessary for proper cell function

I hope this helps a little.

What type of microscope would you use to view a live sample?
1. Scanning Electron Microscope
2.Transmission Electron Microscope
3.Magnifying glass
4. Light Microscope

Answers

Answer:

Compound microscopes

Compound microscopes are light illuminated. The image seen with this type of microscope is two dimensional. This microscope is the most commonly used. You can view individual cells, even living ones.

I need help on this one!​

Answers

Answer:

Classify I beilieve!

Explanation: You would need to do this because in order for you to study it you would have to classify them.

please help me with my science will give brainlest help asap 2 question, please dont answer just for points :(

Answers

Answer:

1. 50cm

2. Direct

Explanation:

1. The distance pulled back means you get your answer from the distance pulled back data. Since 50cm is the largest of your given data, that makes the cart go farthest.

2. The farther you pull the band back, the farther the cart will go. Since both increase when you increase the distance you pull the band back, this is a direct relationship.

Which of these is NOT true about vaccines?
a. they simulate a specific immune response
b. they cause memory cells to be produced
c. they contain an antigen of a weakened pathogen
d. it has been proven that there are many possible negative side-effects to being vaccinated

Answers

Answer:

I'm going to say A

Explanation:

because it just make more sense

A man has Huntington's disease (a dominant trait) and a heterozygous genotype. He has four children with a woman who does not have Huntington's disease. What are the odds their children will inherit Huntington's disease?

Answers

Answer:

50/50

Explanation:

Whenever energy appears in one system,
A.
it must have come from somewhere else.
B.
it means the system is suitable for creating energy.
C.
it must be used quickly or it will be permanently lost.
D.
it means energy creation has outpaced energy destruction.

Answers

Answer:

it must have come from somewhere else.

Explanation:

I did it on studyisland

nutrients are transported to the organs of the bloodstream by which system

Answers

Answer:

The blood circulatory system delivers nutrients and oxygen.

Explanation:

What is the purpose of rRNA?

A. to retrieve amino acids

B. to be a working copy of DNA

C. to assemble proteins

D. to replicate the genetic code in mitosis

Answers

Answer:

A

Explanation:

The primary function of rRNA is in protein synthesis – in binding to messenger RNA and transfer RNA to ensure that the codon sequence of the mRNA is translated accurately into amino acid sequence in proteins.

Do you think aluminum foil is a good insulator or conductor? Why? Give data ( I'm talking about numbers here)

Answers

Answer: hewo, There! your Answer is Below ;w;

aluminum foil reflects the emission of heat, it tends to be a better insulator than other materials that just slow down the flow of heat from one area to another. So It is a Good Insulator,

Explanation:

aluminum foil is a good insulator because it prevents the radiation of heat by reflecting it back at the source.

Hope this helps!

Have a great day!!!

-August-

1. Identify the basic characteristics of a house cat and explain why it belongs in the domain Eukarya and the kingdom Animalia?

Answers

Answer:

House cats have a nucleus in their cells which is why its in the domain Eukarya. It belongs in the Kingdom Animalia because it's an animal, classed in it.

Explanation:

Herbivores are also called _________________________.

Answers

Herbivores are also known as plant eating animals or primary consumers.

Answer:

fruitarian, phytophage , vegan, vegetarian , lactovegetarian , or lactarian

Explanation:

I don't know what you're looking for, but I'm pretty sure that all these are basically the same thing as herbivores, correct me if I'm wrong

PLEASE HELP 5TH GRADE SCIENCEEEE AHHHHHHHHH PLEASE HELP ME IM GONNA FAIL IF I DONT GET THIS Alanna spots a bird in her back yard. The bird is sitting on a tree. Explain how the outer coverings of the bird and tree are different and have different functions.

Answers

Answer:

The purpose of the outer covering of the bird helps keep it warm and to help it fly, whilst the outer cover of the tree is to protect it from bugs. 

Explanation:

Answer: Bird: helps protect it from the environment. Tree: To help reduce water loss.

Explanation:

The outer covering of the bird helps protect it from cold weather, while the outer covering of the tree helps it to reduce water loss.

Please give it a 5 star!

How does acid rain (deposition) form and travel to effect the environment?

Answers

Answer:

The ecological effects of acid rain are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife. As it flows through the soil, acidic rain water can leach aluminum from soil clay particles and then flow into streams and lakes

Explanation:

Can someone plz help

Answers

The answer to your question is the first one
A. The passage of genetic instructions for one generation to the next

true or false
Only animals have a niche.

Answers

Answer:

False

Explanation:

Answer:

True

Explanation:

2. Describe the info flow of transcription. (A. DNA --> DNA / B. DNA -> RNA / C. RNA --> protein / D.
DNA --> protein)
3. Describe the info flow of translation. (A. DNA -> DNA / B. DNA -> RNA / C. RNA --> protein / D. DNA-
-> protein)
4. Describe the info flow of expression. (A. DNA --> DNA/B. DNA --> RNA / C. RNA --> protein / D. DNA
--> protein)
5. Describe the info flow of replication. (A. DNA --> DNA/B. DNA --> RNA / C. RNA --> protein / D. DNA-
-> protein)

Answers

Answer:

I think the dna is like in the butt but I really have no key to my hose

Explanation:

jsnfjfnf

PLSSS HELP IMMEDIATELY!!!!! i need help rn!! only help if u know, i’ll give brainiest if u don’t leave a link

Answers

Answer:

Its keen eye sight helps it to see prey from the sky

Explanation:

Second option, doesn't make sense because their white and brown feathers aren't used for camoflouge  

Third option, bald eagles fly not swim

Fourth option, bald eagles use their beaks for critical tasks, such as building nests, catching food and preening.

La función del sistema digestivo es digerir los alimentos para que puedan ingresar a las células, al respecto, ¿Qué es digerir?

Answers

Answer:

La digestión es importante para descomponer los alimentos en nutrientes, que el cuerpo usa para obtener energía, crecimiento y reparación celular. La comida y la bebida deben transformarse en moléculas más pequeñas de nutrientes antes de que la sangre las absorba y las lleve a las células de todo el cuerpo. ˗ˏˋ ❤︎ ࿐

Explanation:

2. A mouse running away from the sound of an owl's wings is
an example of the mouse's ability to
A. reproduce
B. grow and develop
C. respond to the environment
D. obtain energy
Check Answer

Answers

Answer:

C Respond to the environment

A mouse running away from the sound of an owl's wings is responding to the environment.

What are living organisms?

The organism which can breathe, reproduce and have the ability to respond to an environment are some of the characteristics of a living organism.

Reproduction is the ability of an organism which gives similar kinds of organisms. Organisms grow and develop through cell division. Cell division is of two types mitosis and meiosis. Mitosis is an equational division.

The organism can respond to the environment. Mouse running away from the sound of an owl's wing is an ability to respond environment. Different organisms can obtain energy from food sources.

Therefore,  A mouse running away from the sound of an owl's wings is responding to the environment.

To learn more about sensitivity refer to the link:

https://brainly.com/question/14057226

#SPJ2

Those individuals that are better able to survive in the Environment tend to be:

Answers

Answer:

Fit

Explanation:

They are the ones who are strong enough to survive.

Which organelle is responsible for transporting lipids in the cell? (1 point) O Golgi apparatus O rough ER O nucleus O mitochondrion​

Answers

Answer:

Endoplasmic Reticulum (ER)

Explanation:

The organelle that is responsible for transporting lipids in the cell is Golgi apparatus. The correct option is A.

What is Golgi apparatus?

A Golgi body, also renowned as a Golgi apparatus, is a cell organelle that aids in the processing along with packaging of proteins as well as lipid molecules, mainly proteins destined for cell export.

The Golgi body is a series of stacked membranes which is basically named after, Camillo Golgi the one who discovered it.

The Golgi apparatus transports, modifies, along with packaging proteins as well as lipids into vesicles for delivery to specific destinations.

The Golgi apparatus is a crucial organelle for cargo post-translational modification.

Golgi-resident enzymes including glycosyltransferases, glycosidases, and kinases mediate post-translational modification of secreted and membrane proteins.

Thus, the correct option is A.

For more details regarding Golgi apparatus, visit:

https://brainly.com/question/12233980

#SPJ2

You cross nonpure tall plants (Tt) and produce 200
offspring. Which of the following statements about
the offspring is correct?
A. All of the offspring will definitely be tall.
B. 150 of the offspring will definitely be tall.
C. There is a 75% chance that each offspring
will be tall.
O D. There is a 25% chance that each offspring
will be tall.

Answers

Answer:

C is the best answer

Explanation:

the dominate trait is in 3 of the four boxes

There is a 75% chance that each offspring will be tall. Therefore option C is correct.

When you cross non-pure tall plants (Tt), you are dealing with a heterozygous genotype, meaning the plants have one dominant (T) and one recessive (t) allele for the height trait.

The dominant allele (T) is responsible for the tall phenotype, while the recessive allele (t) leads to short plants. In this case, 75% of the offspring will likely receive the dominant allele from at least one parent (Tt or TT) and therefore be tall.

The remaining 25% will inherit the recessive allele from both parents (tt) and be short. This is based on the principles of Mendelian genetics and the Punnett square.

Therefore option C  There is a 75% chance that each offspring will be tall is correct.

Know more about genotype:

https://brainly.com/question/31515990

#SPJ5

Other Questions
Need help, please... Which of the following inferences about AEgeus is best supported by the text?Answer choices for the above questionA. AEgeus does not trust his son not to overthrow him if he defeats the Minotaur.B. AEgeus lacks the hope and strength of a noble king.C. AEgeus is optimistic about Theseuss return from Crete.D. AEgeus is brave in his plans to eventually go to Crete himself to end the deadly treaty. Why are unfunded mandates difficult for states to deal with Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think abouttheir life cycles. Compare and contrast the life cycles of the four. How do they differ?es ) I really need help with 9 and 10. If you can help Ill figure out how to give your brainliest. 1) What is your biggest struggle with your own mental wellness?2)Are there certain triggers which ignite this struggle? 3)How adept are you at reflecting and evaluatingmy own mental wellness? Sculptural reliefs at Angkor Wat depicting the Churning of the Ocean of Milk suggest that the patron of the complex may have intended to intimidate his audience by depicting acts of violence intended to intimidate his audience by depicting acts of violence A aimed to produce a large number of heirs for posterity aimed to produce a large number of heirs for posterity B desired to become godlike by achieving immortality desired to become godlike by achieving immortality C sought to gain enlightenment through meditative practices NO LINKS!!!!!! Help its urgent, PLEASE HELP!!!!!!!!!!!!!!!! For questions 3 and 4, you will be answering by filling in the blanks. Please be aware that your answer must include any commas or decimals in their proper places in order to be correct. The dollar signs have been provided. For example, if the answer is $1,860.78, then you will enter into the blank 1,860.78. Do not place any extra spaces between numbers, commas, or decimal places. Round any decimals to the nearest penny when the answer involves money, so that $986.526 would be typed into the blank as 986.53 and $5,698.903 would be typed into the blank as 5,698.90 6 Which is NOT a function?A y x = 6B y = 2xC x = -2D y + x = 12 HELP ME RIGHT AWAY PLEASE George's scale drawing of a rectangular volleyball court is 6 inches longby 3 inches wide. What is theactual area if the scale is 1 inch = 8 meters? Tell me what you know about the Great Depression. How was it different from other financial slowdowns? Then, describe how the knowledge learned allowed policymakers to prevent it from happening again(so far) and/or describe Quantitative easing. This has to be a pretty long response! If any of you can answer this without plagiarizing, it would be very helpful! Michael owns a small business selling clothing. He knows that in the last week 39 customers paid cash, 30 customers used a debit card, and 2 customers used a credit card. Based on these results, express the probability that the next customer will pay with a credit card as a decimal to the nearest hundredth. mutations in dna may or may not result in a change in the phenotype of an organism. in which of the following situations will a mutation appear in the phenotype of an individual could someone explain? i don't understand what to do help meh please and thank you!^^ Given m3+m8=180 . Which limiting factor is this adaptation a response to Which one is more important, a producer or decomposer