Help please help i don't know it.

Answers

Answer 1

Answer:

What do you not know?

Explanation:

Sorry I don't see a picture :(


Related Questions

A city installs recycling centers that take wood products. How might the
recycling centers help increase the availability of wood?
O A. Recycling increases the cost of wood.
O B. Recycling increases the consumption of wood.
C. Recycling increases the supply of wood.
D. Recycling increases the demand for wood.

Answers

Answer:

C. Recycling increases the supply of wood

Needed substances are carried to the body cells by:
A)enzymes
B)blood
C)water
D)food

Answers

blood The way needed substances are carried to the body cells.

valves Structure that prevents blood from flowing backward.

capillaries Vessels where materials are exchanged between the blood and the body cells.

ventricle Pumps blood out of the heart

When considering ecosystem biodiversity, why would it be dangerous to treat each ecosystem as an isolated environment?
1. each ecosystem has a constant and consistent number of predators
2. rainfall is global occurrence that impacts every ecosystem on the planet
3. environmental conditions appearing in one ecosystem may appear in another
4. there are complex interactions that take place between ecosystems

Answers

Answer:

1

Explanation:

they can never be mixed

The huge U.S. Army base at Fort Bragg, North Carolina is home to a number of butterflies, plus other endangered animals and plants. Howitzers used during artillery training kill some of the butterflies, but fires started by the howitzer blasts also produce conditions in the base’s forests and wetlands that the butterflies need to survive. This is an example of which characteristic of military bases that makes them useful for conservation?

Answers

Answer: Because they cause a disturbed ecosystems.

Explanation: It is evident that the military base provided both survival and elimination platforms for the butterflies species, translating that the butterflies are living in a disturbed ecosystem.

Hence, this provides a good template to understudy conservation for the purpose of maintaining and making wise-use of important wildlife resources and most importantly, the endangered species. Butterflies species dynamics had been used as an important tool for conservation for years now.

Why aren't human gonads up near our heart like they are in fish?

Answers

Because fish need them near their heart for warmth. Fish often travel in cold temperatures, whereas humans have no need for protection over cold temperatures.

Durante el 2° período académico, los estudiantes de 7° de un colegio de Armenia estudiaron los diferentes tejidos vegetales e hicieron un experimento con una planta de fríjol. Para el experimento, regaron con agua únicamente las hojas superiores de la planta, impidiendo por completo la caída de agua a la tierra en la maceta. Al cabo de 1 mes arrancaron la planta de raíz para estudiar esta zona y se dieron cuenta de que, si bien la tierra estuvo completamente seca durante todo el mes, las raíces se habían mantenido bien hidratadas. ¿Qué tejido podría explicar los resultados observados por los estudiantes de 7°?

Answers

i don’t know spanish sorry

What is likely to happen to a healthy population that is experiencing exponential growth ?

Answers

Exponential growth refers to the increase in the growth of the population with respect to the time. The healthy population will likely to decrease after experiencing exponential growth because the carrying capacity of a region will not be able to sustain the growth of increase in number of individuals.

What is the main function of the endocrine system?

A. secrete hormones

B. send nerve impulses

C. produce blood cells

D. produce DNA

Answers

the main function is A, secrete hormones

Answer:

I think the answer to your question is option A , secrete hormones

In what part of the plant are substances transported to where they are needed?
A. Roots

B. Stem

C. Leaves

Answers

Answer:

B. Stem.

hope it helps

stay safe healthy and happy.

Answer:

B. Stem

Explanation:

In the stem part of the plant are substances transported to where they are needed. So, the option (B) is the correct answer.

Which common resource is being degraded in the photograph?
A. Pastureland
B. Atmosphere
C. Ocean
D. Freshwater

Answers

Answer:

b

Explanation:

The direction of force of Earth's magnetic field is from the geographic South
Pole to the geographic North Pole. Where is Earth's magnetic north pole?
O A. Near Earth's center
O B. Near Earth's equator
O C. Near Earth's North Pole
O D. Near Earth's South Pole

Answers

I am pretty sure it’s D) Near Earth’s South Pole, I’m so sorry it’s it’s wrong

helppppppp plzzzzzzzzzzzzzzzzz

Answers

Answer:

A

Explanation:

Im not sure what this is but im pretty sure its A it just seems the most logical but once u get someone good to answer this tell me if u got it right or not im curious bhaaajjajaja

A 43-year-old Caucasian man with a 20-year history of bipolar disorder presents for the first time with long-term polyuria and polydipsia. He previously took lithium for mood stabilization for 15 years before initiating divalproex sodium therapy. He stopped using lithium because of the polyuria, but he felt that the polyuria never fully subsided. His weight is stable, and he has no other urinary complaints. His blood pressure is 115/80 mmHg and his physical exam is normal. His urinalysis shows no blood, cells, protein, glucose, nitrate, casts, or crystals.
What is the most likely cause of his polyuria?
1 Central diabetes insipidus
2 Nephrogenic diabetes insipidus
3 Polyuria secondary to hyperglycemia
4 Polyuria following acute kidney injury
5 Polyuria secondary to polydipsia

Answers

Answer:

The correct option is 2 Nephrogenic diabetes insipidus.

Explanation:

Nephrogenic diabetes insipidus (NDI) occurs when the renal tubule response to vasopressin (ADH) is weakened, resulting in the excretion of large volumes of dilute urine.

As the renal tubules do not respond to vasopressin (antidiuretic hormone) and are unable to reabsorb filtered water back into the body, the kidneys create a high volume of dilute urine in nephrogenic diabetes insipidus.

Nephrogenic diabetes insipidus (NDI) can be inherited or develop as a result of disorders that impede the ability of the kidneys to concentrate.

Therefore, the correct option is 2 Nephrogenic diabetes insipidus.

That is, the most likely cause of his polyuria is nephrogenic diabetes insipidus.

IS THIS CORRECT?? IF NOT WHATS THE ANSWER PLEASE

Answers

Yup it is correct

Hope u get good marks stay safe
:D

What are the products (comes out) of cellular respiration? (select all that apply)
A. Carbon dioxide

B. oxygen

C. Water

D. Glucose (sugar)

Answers

ANSWERS
A. carbon dioxide
B. glucose (sugar)
Yo WaSsuPp!!   ^v0!!

                         What are the products (comes out) of cellular respiration? (select all that apply)

A. Carbon dioxide

B. oxygen

C. Water

D. Glucose (sugar)

 Well Well Hello again XD, trust me when i say i'm not stalking you UvU...i'm just really into biology XD

Anyway the answer to your question is:

               Carbon dioxide and Water!!I apologize if i'm wrong//You're welcome if i'm correct

((-Side Note-)): glad i could help lol

                            I hope you have a great day ^v^"

Plant cell walls connect with other plant cell walls to create plants
A. organelles
B. mega cells
C. vacuoles
D. tissue

Answers

It’s B.Mega cells…..

A Canyon landscape is of economic importance to an area. Explain
how this landscape can be utilized to secure economic sustainability
to the inhabitants.​

Answers

Answer:

.

Explanation:

............................

The financial advantages of a canyon landscape are contingent on careful management and long-term use. Careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.

What is Canyon landscape?

A canyon landscape is a form of topography characterised by deep and narrow valleys with sides that are steep, which are frequently created over time by a river or other water sources. Canyons varies in size spanning small gorges to enormous networks of interconnected valleys and can be found all over the world, from barren deserts to lush forests.

Canyons are primarily formed by erosive processes that include water, wind, and ice, that erode away the soil and rock gradually over time. The canyon walls get steeper and more prominent as the surrounding ground erodes, creating a distinct environment that is frequently physically attractive and ecologically varied.

Therefore, careful preparation and oversight can ensure that the canyon's natural resources and attractiveness are conserved while also benefiting the local community's economic well-being.

Learn more about Canyon landscape, here:

https://brainly.com/question/22035152

#SPJ2

Blood is at it's highest pressure just when it leaves the heart. Why so?

Answers

Answer: Contractility of the left ventricle myocardium ensures that blood will have enough force to reach the rest of the body.

Explanation: Frank Starling Law....Cardiac output=heart rate x stroke volume.

what is a good definition of photosynthesis?
A. using glucose to create light

B. putting together lights so we can see

C. using light to put together food (glucose)

Answers

Answer:

The best answer is C

Explanation:

Plants use light  to create their own food. this is called  photosynthesis

Answer:

C

Explanation:

The process of photosynthesis uses light to create food and uses other gas like carbon dioxide.

Choose three things that blood transports throughout the body.

Nerve impulses

French fries

DNA

nutrients

wastes such as CO2

oxygen

Answers

Answer:

nutrientswastes such as CO2oxygen

Explanation:

Blood brings oxygen and nutrients to all the parts of the body so they can keep working. Blood carries carbon dioxide and other waste materials to the lungs, kidneys, and digestive system to be removed from the body. Blood also fights infections and carries hormones around the body.

The body's transportation system, the blood, transports innumerable compounds to different parts of the body. Blood carries three things throughout the body: Oxygen, nutrients, and wastes such as carbon dioxide (CO2).

1. Blood carries oxygen from the lungs to all the cells of the body. Cellular respiration requires oxygen to generate the energy (in the form of ATP) that drives many bodily activities.

2. Blood carries nutrients absorbed by the digestive system to cells throughout the body. These nutrients, which are essential for growth, repair and building energy, include glucose, amino acids, fatty acids, vitamins and minerals.

3. Wastes such as [tex]CO_2[/tex]: Removes carbon dioxide from the blood cells, which is a byproduct of cellular metabolism, and carries it to the lungs for expiration. The acid-base balance of the body is maintained by this mechanism.

Learn more about Blood, here:

https://brainly.com/question/32316698

#SPJ6

IS THIS CORRECT IF NOT WHATS THE ANSWER FAST PLS

Answers

Yep, that is a good answer!

which process reduces the number of chromosomes by half

Answers

Answer:

Meiosis process reduces the number of chromosomes by half.

Explanation:

Meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells.

Answer:

meiosis

Explanation:

meiosis is a type of cell division that reduces the number of chromosomes in the parent cell by half and produces four gamete cells

Explica qué son los codones y los anticodones La siguiente secuencia de nucleótidos de ADN codifica para una secuencia de aminoácidos que forman una proteína hipotética, encuentre la secuencia de codones, anticodones y aminoácidos que se forman 5 ` A T G A G C A C C C A A A C T T G C TC T T A T T C T A A A A A G A C T 3

Answers

Answer and Explanation:

La informacion genetica de ensamblaje de aminoácidos durante la sitntesis proteica, se almacena en unidades llamadas codones.

Un codón es una secuencia corta de tres nucleotidos provenientes de la cadena de ADN o ARN mensajero. Cada codón representa uno de los 20 aminoácidos disponibles para sintetizar la proteina. En total hay 64 codones, de los cuales 61 codifican aminoácidos (mas de un codón puede codificar para el mismo aminoácido), de los cuales uno de ellos a parte es el codon de inicio de sintesis proteica. Los restantes tres codones corresponden a codones de finalización.

El anticodón es la secuencia de nucleótidos presentes en ARN de transferencia, que complementa a cada codón de ARN mensajero. De esta forma el ARNt reconoce el aminoácido correspondiente y lo ensambla en la nueva proteina.

ADN ⇒ 5 ` ATGAGCACCCAAACTTGCTCTTATTCTAAAAAGACT 3

Codones   ATG-AGC-ACC-CAA-ACT-TGC-TCT-TAT-TCT-AAA-AAG-ACT

ARNm ⇒  UACUCGUGGGUUUGAACGAGAAUAAGAUUUUUCUGA

Codones  UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

Recordá que para ARNm, la secuencia de nucléotidos debe ser la complementaria para ADN.

Anticodones de ARNt ⇒ Complementarios a los codones de ARNm. Recordá que para los ARN, la timina se reemplaza por uracilo.

AUG-AGC-ACC-CAA-ACU-UGC-UCU-UAU-UCU-AAA-AAG-ACU

La proteina se construye en función de la información del ARNm, es decir que para la selección de aminoácidos, se consideran los codones del ARNm, y no los anticodones de ARNt.

UAC-UCG-UGG-GUU-UGA-ACG-AGA-AUA-AGA-UUU-UUC-UGA

TYR  SER  TRP  VAL   Stop  THR  ARG  ILE  ARG  PHE  PHE  Stop

What is the smallest LIVING part of an organism?

A. Molecules

B. Cells

Answers

Answer:

Hi, there the answer is a cell

Explanation:

The smallest living part of an organism is a cell. The cell is the smallest structural and functional unit of living organisms, which can exist on its own.

Answer:

B. Cells

Explanation:

The cells are the smallest living part of an organism.

please help me answer this

Answers

Answer:

last one a dormancy structure D

Explanation:

It helps keeps bacteria and stuff dormant`

Nick has had a very stressful job for more than 10 years. At Nick’s annual doctor’s visit, what effects would the doctor most likely identify in Nick?

Answers

Answer:

don't known ask the goggle

Complete the T-chart by categorizing each environmental factor as something that would most likely increase or decrease genetic variation. Some answers will fit in both columns depending on the situation.

Predator-prey relationships
Competition
Toxins
New habitat
Disasters
Increased food source
A 2-column table has columns with labels Increase variation and decrease variation.

Answers

Answer: 1. Decrease 2. Decrease 3. Both 4. Both 5. Decrease 6. Increase

Explanation: I got it right hopefully it helps

Answer:just did it

Explanation:

Which of the following organelles is properly matched to it's function?


lysosome: storage

endoplasmic reticulum: movement

lysosome: digestion

chloroplast: making proteins

Answers

The organelle properly matched to it's function is

-(C) lysosome: digestion

Explanation:

Lysosomes : It hold enzymes that were created by the cell. The purpose of the lysosome is to digest things. They might be used to digest food or break down the cell when it dies

Endoplasmic reticulum : to produce proteins for the rest of the cell to function.

Chloroplast : They are responsible to carry out photosynthesis

what do you mean by faunal Diversity

Answers

Answer:

animal life especially

Explanation:

i hope it helps

this is my answer

correct me if im wrong

#carryonlearning

what are alleles mutations in the dna

Answers

Answer:

Mutations Are Recessive or Dominant

Other Questions
The sides of the cuboid are 20cm 5cm and 10cm what is the surface area help, please. everything is in the pictures. also the 2nd pic is the options in the drop-down bar thing :) Consider systematic discrimination, contextual discrimination, institutional and individual acts of discrimination. Which do you believe is the most problematic for the criminal justice system as we know it today? Discuss. Determine if the given relation is also a function.{(-2,-6), (-2,8), (-2,5)}Is the relation a function?NoYes transformer crivez les phrases au pass compos et ajoutez les adverbes entre parenthses. 1. Ces deux journalistes disent la vrit (toujours)2. Est-ce que vous regardez la tlvision pendant les vacances? (beaucoup)3. Nous coutons la bande originale de ce film. (rcemment)4. Le ralisateur oublie ses rendez-vous. (probablement)5. Tu retournes au studio? (vite) A ball falls 5 m and then bounces to a height of 3 m. What height is the bestreference point for the motion of the ball?A. 2 mB. OmC. 5 mD. 3 mSUBMIT Identify and explain the phenomenon represented by the arrows diagram . Solve for x Log2 x=-5 wqektrethmn,jhrethj,hjtrehgmferwhferhfrterh PLEASE HELP ASAP, THIS IS A TIMED MATH QUESTION!!!I'LL MARK BRAINLIEST FOR CORRECT ANSWERS! Give example of creating middle ways in a moral way. Find the length of AB and round answer to the nearest hundredth Which two lines in the excerpt use dramatic irony?Romeo and Julietby William Shakespeare (excerpt)CAPULET: How now, my headstrong! where have you been gadding?JULIET: Where I have learn'd me to repent the sinOf disobedient oppositionTo you and your behests, and am enjoin'dBy holy Laurence to fall prostrate here,And beg your pardon: pardon, I beseech you!Henceforward I am ever ruled by you.CAPULET: Send for the county; go tell him of this:I'll have this knot knit up to-morrow morning.JULIET: I met the youthful lord at Laurence' cell;And gave him what becomed love I might,Not step o'er the bounds of modesty. From your findings, what conclusions and recommendations can you make on theissue of human rights violations to:Government; andCommunities Help out please !!!! HELlLlLlPllLl is it 10219 Almost 99% of Earth's atmosphere is made up of two gases. What are the two gases and the percents of each?A)21% oxygen and 78% nitrogenB)21% water vapor and 78% oxygen0921% nitrogen and 78% oxygenD)21% carbon dioxide and 78% oxygen Un hombre parado en el techo de un edificio, tira una bola verticalmente hacia arriba con una velocidad de 12m/s, la bola llega al suelo en 4s. que altura tiene el edificio ? Answer this question fast please In this passage, the mother tries to use an English idiom about having ones name in lights, which means to be famous. Instead, she says that Yoyo will bring their name to the headlights in this country.What does the mothers language reveal?What does the mother mean to express about her daughter Yoyo?