help-- multiple choice!
Biogenic sediment is made of at least 30 percent...

acidic chemicals

alkaline properties

limestone or other rock

skeletal remains

Answers

Answer 1

Answer:

The answer is the last one, skeletal remains

Answer 2

Answer: Skeletal remains


Related Questions

This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism

Answers

Answer:

A. Mutualism

Explanation:

The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.

A.Mutualism. hshshshshs

How is energy produced by respiration stored

Answers

Answer:

Explanation:

Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.

Answered by the ONE & Only #QUEEN aka  #DRIPPQUEENMO

Hope this helped!!!


Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)

Answers

The best answer to go with is b you’re welcome

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

Earth science question. Please help

Answers

Answer:

answer choice 4, more rain and a steeper slope cause it to flow faster

Explanation:

Which of the following represents the correct order of the phases of the
Moon?

A. new moon, full moon, last quarter, first quarter, and then new moon again

B. full moon, new moon, last quarter, first quarter, and then full moon again

C. full moon, last quarter, new moon, first quarter, and then full moon again

D. last quarter, full moon, new moon, first quarter, and then last quarter again

Answers

Answer:

c

Explanation:

full and new moons aren't back to baxk

what does the respritory system do?

Answers

Answer:

The respiratory system's main job is to move fresh air into your body while also removing waste gases.

Explanation:

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.

3 examples of radioactive dating?

Answers

Answer:

Uranium 238

Potassium 40

Rubidium 87

Explanation:

Explain the lifecycle of mosquito in short​

Answers

Answer:

Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)

plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.

Answers

I think is would be A i hope it helps

¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?

Answers

Answer:

La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:

tRNA uses (anticodons/codons) to match to the mRNA.

Answers

Answer:

anticodons

Explanation:

codons are for mRNA

tRNA uses anticodons to match to the mRNA.

Which one does tRNA uses?

tRNA (transfer RNA) molecules are responsible for carrying specific amino acids to the ribosomes during protein synthesis.

They have an anticodon region that consists of three nucleotides that are complementary to the codons on the mRNA (messenger RNA). The codons on the mRNA determine the sequence of amino acids in the growing polypeptide chain.

The anticodon on the tRNA base pairs with the complementary codon on the mRNA, ensuring that the correct amino acid is incorporated into the growing protein chain. The matching between the anticodon and codon is essential for the accurate translation of genetic information into protein synthesis.

Learn more about tRNA at:

https://brainly.com/question/4089622

#SPJ6

Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.

_____ Motor neurons cause muscles to contract so the body can react to the stimulus.

_____ The brain processes the information through interneurons.

_____ Interneurons transfer response information to motor neurons.

_____ Sensory neurons carry stimulus information to the brain or spinal cord.

Answers

Answer:

The correct answer is -

1 - The stimulus is received by sensory receptors.

2 -  Sensory neurons carry stimulus information to the brain or spinal cord.

3 -  The brain processes the information through interneurons.

4 -  Interneurons transfer response information to motor neurons.

5 - Motor neurons cause muscles to contract so the body can react to the stimulus.

Explanation:

In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.

These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.

help................

Answers

The top left, would be light energy from the sun, while the top of the circle would be living beings. Think about it just like plants that that gain energy from the sun through photosynthesis. Then the bottom of the circle would be nonliving beings, either decomposed plants or animals that bring nutrients to soil, or dead ones that we eat. This cycles through until the energy is rereleased through heat. Therefore the top right would be heat energy, every living thing on earth creates gradual amounts of heat. Imagine going for a run, you'll probably be hotter afterwards right? I know it's not the most scientific answer but its 100% right.

Hope this helps!

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

I will mark Brainliest for frist answer

Answers

Answer:C, to contain the information

Explanation:

If a population is evolving, the allele frequency ________

Answers

If a population is evolving, the allele frequency will change.
Answer: Change

Which organelle of a cell functions similarly to the envelope of a virus and why?

Answers

Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.

What is the relationship between the rock cycle and the plate tectonics?

Answers

Answer: The metamorphic rocks can erode into sedimentary rocks which can turn into igneous rock. Metamorphic rocks in the rock cycle is driven by tectonic plates.

Explanation:

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

Bill Nye Earth's crust

Answers

1. rock
2. on
3. mantle
4. volcanoes
5. active
6. lava
7. hot
8. coolest
9. geyser
10. resistant
11. tectonic
12. tectonic/pangea
13. caves
14. earthquake
15. crust

Answer:

1. rock

2. on

3. mantle

4. volcanoes

5. active

6. lava

7. hot

8. coolest

9. geyser

10. resistant

11. tectonic

12. tectonic/pangea

13. caves

14. earthquake

15. crust

Explanation:

Which process begins the formation of sedimentary rock?

Answers

Weathering breaks down pre-existing rock into particles, while erosion moves the particles to a site of deposition. These processes begin the formation of sedimentary rock. ... Sediment can be moved by wind, running water, ice, or waves.

Carbon dioxide enters a plant through pores (openings) called the
A. stomata.

B. cuticle.

C. veins.

Answers

A. stomata

I hope this helps good luck!! :)

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

Cell differentiation causes embryonic
cells to become which of these cells? A) prokaryotic cells B) specialized cells C) stem cells

Answers

Answer c

Explanation:

The energy that powers photosynthesis comes from
A. oxygen.

B. water.

C. the sun.

D. chemicals.

Answers

Answer:

sun but am not so sure about it

When a person loses consciousness due to a head injury from a car crash, the ______ keeps the body functioning by regulating the flow of information between the brain and the rest of the body

Answers

Answer:

Brain stem

Explanation:

I hope this helps

As a result of the experiment scientists did with Mexican tetras, it seems likely that their first hypothesis about blindness in the tetras is right. Explain how the result of the experiment supports their first hypothesis.

The scientists' first hypothesis is that blindness gives the fish some sort of evolutionary advantage, but not directly.

The experiment was: The scientists transplanted a lens from the eye of a surface tetra embryo into the eye of a cave tetra embryo. The result was striking—the surface tetra lens into the cave tetra caused all of the surrounding tissues to develop into a healthy eye.

Answers

A result that supports the hypothesis 'blindness gives the fish some evolutionary advantage, but not directly' may be a higher fitness in close relatives of fish.

What is a hypothesis?

An scientific hypothesis is a given explanation to a scientific observation from the real world.

A hypothesis must be verifiable, which means that it can be confirmed or rejected by using the scientific method.

In conclusion, a result that supports the hypothesis 'blindness gives the fish some evolutionary advantage, but not directly' may be a higher fitness in close relatives of fish.

Learn more about hypotheses here:

https://brainly.com/question/11555274

#SPJ1


Can someone please help me on this plz I beg u :(

Answers

Answer:

Coleoptera is correct! Hope this helps.

ANSWER IS Coleoptera

what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?

Answers

the answer is hematopoiesis
Other Questions
Find x in the following ,giving reasons Under the Sun King, intendantsa. collected taxes.b. recruited soldiers.C.carried out the king's policies.d. all of the above. I'm writing an essay about how schools affect mental health. I need one more topic to write about and I was wondering if anyone could give me some ideas. 7. Geometry Which set of ordered pairs can beconnected in order to form a right triangle?A (-1,3), (FT, -1), (2, -1)B (-4, 0), (0, 1), (1, -2)C (2, 2), (2, -2), (-2, -2), (-2, 2)D (0,5), (-3, 3), (3, -3) What volume of solution is required to produce a 7.8M solution containing 23.6g of LiBr? 7TH GRADE SOCIAL STUDIESAssignment 07.04 The English Reformation (Interviews with the Past)Directions: In Lesson 07.04, you studied the Reformation in England and the Tudor Dynasties. For this assignment, you will conduct mock interviews of the following historical figures: Henry VIII, Mary I, and Elizabeth I. Using the questions below, pretend you are interviewing your historical participants individually and record the answers each would give. You will use evidence from your text and other resources to determine what your interview subjects answers would be. When you have finished, you should have three (3) complete interviews. Upload your interviews to the My Assignments folder. Select the link entitled Assignment 07.04 The English Reformation (Interviews with the Past) and submit your assignment. The interviews are worth 100 points. Interview Questions:1. What were your major accomplishments?2. What were your mistakes or regrets?3. How did you influence others during and beyond your life?4. Tell me about your family. Who were your parents? Did you have any siblings? Were you married? Did you have children? If so, what were their names?5. Were you a religious person? If so, what were your beliefs?6. If you were alive today, what changes would you like to make in your community?7. [Come up with your own question specific to this historical figure and insert it here.]Rubric: Use the grading rubric below to guide you as you complete your timeline. The rubric specifies the expectations for completing the assignment, as well as the quality expected to earn the designated grade. Your teacher will use the rubric to score and explain your final grade.Grading RubricRating/Grade: Key Indicators:Exemplary85-100 Comprehensively answers 6-7 interview questions for each historical figure. Includes at least one (1) key historical fact for each answer. Neatly organized using the format provided. Easy to comprehend. Exceptional communication of ideas. 0-2 errors in grammar or spelling that do not detract from the overall quality. Commendable70-84 Adequately answers at least 4-5 interview questions for each historical figure. Includes at least one (1) key historical fact for each answer. Work is relatively neat and demonstrates an attempt to follow the format provided. Capably communicates ideas. 3-5 errors in grammar or spelling that do not affect understanding of the text.Novice0-69 Answers 3 or fewer interview questions for each historical figure.Information may be missing, inaccurate, or lacking adequate detail. Work is not organized using the format provided. Difficulty in communicating ideas. More than 5 errors in grammar or spelling rendering meaning unclear. How did China change during the song dynasty. Land, and not gold, was the major point of conflict between Native Americans and colonists in ___. Please someone help me and all of the terms do not have to eh used ! ____________A. HuboB. Habamuchos tomates! Forms that have straight edges, sharp angles, and rectangular planes are referred to as ???A. Rectilinear B. Curvilinear C. Abstract D. Biomorphic I didnt realize this was due, please help! You have learned about the history and basic beliefs of communism. In this report, you will learn more about communism in an Eastern European country.Here is your goal for this lesson:Research a communist countryChoose any country (or a city within the country) that you have studied in this unit. These include Russia, Poland, The Czech Republic, Slovakia, Hungary, Germany, Romania, Bulgaria, Albania, Croatia, Macedonia, Slovenia, and Bosnia-Herezegovina. Using the Internet, an encyclopedia, or other resources, research the period of communism in the chosen country, and write a report in which you describe what life was like for the citizens during the era of communism. Your report should be approximately 300 words in length. After this is 2 more pls help asap. Thanks and have a great day! What is one-fifth of a number, x, increased by 24 is equal to eight tenths of the same number, x. You and your friend each have a canvas of the same size. You divide your canvas into 5 sections and paint 3 of them. Your friend divides her canvas into 7 sections and paints 4 of them. Who paints more? Pls help meIm not sure with my answer Pls put the right answer Simplify the following expression by combining like terms: *-2g - 8 +5g - 5 Which two molecules are produced over the course of the light and dark reactions of photosynthesis?glucosewatercarbon dioxidepyruvic acidoxygen help please , i need it asap ! ty what was life like in the south for african americans before civil rights movement