Find the lcm of 5m^7+ 35m^6+50m^5 And -20m^5-80m^4+100^3

Answers

Answer 1

Answer:

LCM of both polynomials=[tex]\mathbf{5m^3}[/tex]

Step-by-step explanation:

Least Common Multiple

We are given the polynomials

[tex]5m^7+ 35m^6+50m^5[/tex]

[tex]-20m^5-80m^4+100m^3[/tex]

Find the common factors of each polynomial, first the coefficients:

5 = 5

35 = 5*7

50 = 5*5*2

The common factor with the least exponent; 5

Now for the variables:

[tex]m^7, m^6, m^5[/tex]

The common factor with the least exponent; m^5

LCM of [tex]5m^7+ 35m^6+50m^5: 5m^5[/tex]

Similarly:

20 = 2*2*5

80=2*2*2*2*5

100 = 2*2*5*5

Common factor of the coefficients: 2*2*5=20

Common factor of variables: [tex]m^3[/tex]

LCM of [tex]-20m^5-80m^4+100m^3 = 20m^3[/tex]

LCM of both polynomials=[tex]\mathbf{5m^3}[/tex]


Related Questions

I don’t get 9.) so if anyone can’t skip it I need help with 10.) too

Answers

Answer:

ok number 9.) i believe its 7 if im wrong im so sorry

Step-by-step explanation:

Answer:

I will help with 10 i don't get 9 sorry so the answer is (a) F(5,4)

Step-by-step explanation:

So you have the midpoint and you put f(x, y) and D(-3,-8)

So

E=(x-3/2, y-8/2) =(1,-2) so

X-3/2 =1 , x-3=2 so x = 5

And y-8/2 = - 2. , so y-8 = - 4. , so y =4

So F =(5, 4)



16. Find the length of the median CD.
17. Find the coordinates of E, the midpoint of BC
18. Find the length of the median AE.

Answers

Step-by-step explanation:

16. Length of a line = sqaureroot of ((x1-x0)^2 - (y1- y0)^2)

C (2,-3) D (6,3)

CD = sqaureroot of ((6-2)^2 + (3-(-3))^2)

CD = sqaureroot of ( 16 + 36)

CD = sqaureroot of 52 = 2 root 13 = length

17. E (5, - 1) because the point is under the x axis.

Midpoint = ((x1+ x0)/2 , (y1 +y0) /2)

B (8,1) C (2, - 3)

Midpoint of BC = ((2+8)/2 , (-3+1)/2)

= (10/2 , - 2/2)

= (5, - 1)

18. Length of AE

A (4,5) E(5,-1)

Square root of ((5-4)^2 + (-1-5)^2)

Square root of (1^2 + - 6^2)

Square root of ( 1 + 36)

Square root of 37 = root 37

Please gimme brainliest

AnOtHer geometry question.

Answers

Answer:

the answer is 8!

Step-by-step explanation:

Estimate the unit rate to the nearest hundredth $2.35 12 Grade AA eggs.

Answers

Answer:

2.4

Step-by-step explanation:

I need the answer please help me

Answers

Answer:

-29.988 or if you round up -30

Step-by-step explanation:

1) Convert fractions to decimals  

    3.6 x (-8.33) = -29.988

Answer:

I think its this but not sure

A triangle weighs 3 grams and a circle weighs 6 grams. Find the weight of a square in Hanger A and the weight of a pentagon in Hanger B. Create equations for each hanger using the information given above! Write an equation to represent each hanger.

Answers

Answer:

Equation of Hanger A:

x + y = z

z = 9 grams

Equation for hanger B

x + y = p

p = 9 grams

Step-by-step explanation:

Note: This question is not complete, and lacks necessary data to answer this question. But for the sack of concept, we wil be solving this question using our own data.

Data given:

Triangle weight = 3 grams

Circle weight = 6 grams

There are two hangers A and B.

We have to find weight of the square in Hanger A and weight of the pentagon in Hanger B.

So, for your understanding I have drawn the two hangers A and B. In A we have triangle and circle on the LHS and the square on the right. On the other hand, we have pentagon on the right and triangle and circle.

Sketch is attached in the attachment.

Let's suppose: Hanger A is balanced, So,

Triangle weight = 3 grams = x

Circle weight = 6 grams = y

weight of the pentagon in Hanger B = p

weight of the square in Hanger A = z =?

So,

Equation of Hanger A:

x + y = z

z = 3 + 6

z = 9 grams  = weight of the square in Hanger A

Similarly for Hanger B.

Equation for hanger B

x + y = p

p = 3 + 6

p = 9 grams

a motorboat moves across a lake at a constant speed. when it begins it from the shore. after 9 minitues it is 14 km from the shore. which function decribes the motorboat distance from the shore?
a. y= 4x + 50
b. y= -4x + 50
c. y= 9x + 50
d. y= -9x + 50

Answers

Answer:

Answer:

The function describes the motorboat's distance from the shore  

Step-by-step explanation:

A motorboat moves across a lake as a constant speed. when it begins, it is 50 km from the shore

After 9 minutes, it is 14 km from the shore.

So, rate of change =  

Negative sign shows that there is decrease in distance per minute

The rate of change of distance is 4 km / minutes

General equation : y = mx+c

Where m is the slope and c is the constant

Substitute the values in the equation :

y=-4x+50

Where y is the final distance and x is the minutes

So, Option C is true

Hence The function describes the motorboat's distance from the shore

Step-by-step explanation:

Please help, find the measure of angle 1 (geometry)

Answers

The angle is 40 degrees

Sarah had 36 free throw attempts during a game and made at least 75% of the free throws.

What is the greatest number of free throws Sarah could have missed during the game?

Answers

Answer:

9 free-throws

Step-by-step explanation:

75% of 36 = 27

36-27=9

She could have missed up to nine free throws

Answer:

3

Step-by-step explanation:

25% of 12 is 3. Brainliest pls :)

I don’t rlly need the answer I just would like the method please
3x-7=17-5x

Answers

Answer: x=3

Step-by-step explanation:

3x-7=17-5x

-7=17-8x (subtract both sides by 3x)

-24=-8x (subtract both sides by 17)

3=x (divide both sides by -24)

help me plsss!!!!!!!!

Answers

Answer:

the answer is b

hope that helps

What is the Equation of the Line Passes through the points (-4,8) and (1,3)

show work please, i need these asap and thx for trying :)

Answers

Answer: y = –x + 4

Explanation:

y=-x+4 is the Equation of the Line Passes through the points (-4,8) and (1,3).

What is Slope of Line?

The slope of the line is the ratio of the rise to the run, or rise divided by the run. It describes the steepness of line in the coordinate plane.

The slope intercept form of a line is y=mx+b, where m is slope and b is the y intercept.

The slope of line passing through two points (x₁, y₁) and (x₂, y₂) is

m=y₂-y₁/x₂-x₁

The slope of line passing through points (-4,8) and (1,3)

m=3-8/1+4

=-5/5=-1

Now we need to find the y intercept

8=-1(-4)+b

8=4+b

b=4

Hence, y=-x+4 is the Equation of the Line Passes through the points (-4,8) and (1,3).

To learn more on slope of line click:

https://brainly.com/question/14511992

#SPJ2

*WILL GIVE A BRAINIST*
GEOMETRY

Answers

I’m not really sure, but I think it is C. XY=7. If it’s wrong, I am terribly sorry.

pls help meeeeee
if you can
I'll give you brainy

Answers

Answer:

x=100°, y=85°

Step-by-step explanation:

I'm pretty sure about it. If you need explanation, I'll give it later. Thank you.

find the equation of the circle with center at (3 -2) and radius of 3.

Answers

Answer:

(x - 3)² + (y + 2)² = 9

General Formulas and Concepts:

Pre-Calculus

Equation of a Circle: (x - h)² + (y - k)² = r²

(h, k) is centerr is radius

Step-by-step explanation:

Step 1: Define

Center (3, -2)

h = 3k = -2

Radius r = 3

Step 2: Write Equation

Substitute [EC]:                    (x - 3)² + (y + 2)² = 3²Exponents:                           (x - 3)² + (y + 2)² = 9

The drama club spent $450 on tickets and buses for a field trip to the theater. 15 members of the drama club attended the field trip. The total cost for the buses was $60. What was the cost of each theater ticket? Pick the correct equation and then solve for the cost of each theater ticket.

Answers

Answer: 525

Step-by-step explanation:

450+15+60=525

Answer:

The cost of each ticket is $30.

Step-by-step explanation:

$450 is the total cost, so to get individual ticket prices you need to divide by the total number of drama club members.

450 ÷ 15 = 30

Solve the equation! ^w^

Answers

Answer:

Your correct answer would be 1

5h=srt solve for t please help

Answers

Answer:

5h/sr=t

Step-by-step explanation:

To get t alone basically all you do is divide 5h by s and r.

So the new equation would be 5h / sr = t

Last night, the temperature fell from 0°F to -13 in 4 § hours. What was the average temperature change per hour? Solve the division problem. 2 1 -13= - 4 5 5 The temperature drop per hour can be represented by I °F. QUICKLY​

Answers

Answer:

3.25 degrees/hour

Step-by-step explanation:

Last night, the temperature fell from 0°F to -13°F in 4 hour.

We need to find the average temperature change per hour. It can be calculated by dividing the change in temperature per unit time.

Change in temperature = -13°F -0°F = -13°F

So,

[tex]C=\dfrac{-13}{4}\\\\=-3.25\ \text{degrees/hour}[/tex]

So, the change in temperature is 3.25 degrees/hour.

Answer:

-3.25 degrees an hour

Step-by-step explanation:

-13 ÷ 4 = -3.25

translate the phrase twice m increased by 2 is equal to 7 more then m
pls show your work plss
thx
A. m/2 + 2 = 7 + m
B. 2m + 2 = 7 + m
C. 2m + 2 = m + 7
D. 2m * 2 = m + 7

Answers

The answer to this question is B

What is the value of 1 − 2sin2(105°)?


a Negative StartFraction StartRoot 3 EndRoot Over 2 EndFraction

b Negative one-half

c One-half

d StartFraction StartRoot 3 EndRoot Over 2 EndFraction

Answers

Answer:

D. d StartFraction StartRoot 3 EndRoot Over 2 EndFraction

Step-by-step explanation:

What is the value of 1 − 2sin^2(105°)?

Given the expression

1 − 2sin²(105°)

= 1 - 2(sin105)²

= 1 - 2(0.9659)²

= 1 - 2(0.9330)

= 1 - 1.8660

= 0.8660

0.8660 can also be expressed as √3/2

Hence  1 − 2sin²(105°) is  √3/2

Answer: D

Step-by-step explanation:

It IS sqrt3/22

Which expression correctly represents “six more than the quotient of three and a number, decreased by eight”?
6 + StartFraction 3 Over n EndFraction minus 8
6 + StartFraction n Over 3 EndFraction minus 8
6 + StartFraction 3 Over n EndFraction + 8
6 + StartFraction n Over 3 EndFraction + 8

Answers

Answer:

C

Step-by-step explanation:

Because yeahhhh

Answer:

C

Step-by-step explanation:

Jervane is planning on buying a coffee and several donuts for a road trip. She wants to spend no more than $20 in total. Coffee costs $3 and donuts are $2 each. Write and solve an inequality to determine the maximum number of donuts that Jervane can buy. Be sure to include units on your answer.

Answers

Answer:

8

Step-by-step explanation:

Given:

Total money Jervane can spend = $20.

Cost of a coffee = $3.

Cost of a donut = $2.

To find: Maximum number of donuts Jervane can buy.

Solution:

Let the number of donuts she can buy be [tex]x[/tex].

She wants to spend no more than $20 in total.

So,

[tex]3+2x\leq 20[/tex]

[tex]\Rightarrow 2x\leqslant 20-3[/tex]

[tex]\Rightarrow 2x\leqslant 17[/tex]

[tex]\Rightarrow x\leqslant \frac{17}{2}[/tex]

[tex]\Rightarrow x\leqslant 8 \frac{1}{2}[/tex]

As the number of donuts can only be a natural number.

Hence, the maximum number of donuts that Jervane can buy are 8.

Kristen used the expression 82 - 22.2-52, what is the
value of it?

Answers

Answer:

the answer to this is 7.8

the question is in the picture. will give brainilist​

Answers

Answer:9x°

Step-by-step explanation:

Nina Milling assembles transistor radios. she is paid $0.54 for each radio assembled during a regular work week, $0.62 for each radio assembled on on sundays. What is Nina's total pay for a week in which she assembled the following number of radios?

Answers

Answer:

I would need to know the number of radios she made each day.

Step-by-step explanation:

lets say she assembled 2 radios a day, which means we would do 0.54 x 2 (that would be 1.08) and then times it by 6 ***not incuding sunday***

you would get $6.48

then for sunday we would do 0.62 x 2 (that would be 1.24) .

now we add 6.48 and 1.24 to get $7.72 a week.

What is the slope line through 1,-1 and 6,2

Answers

Answer:

[tex]\huge\boxed{slope=\dfrac{3}{5}=0.6}[/tex]

Step-by-step explanation:

The formula of a slope:

[tex]m=\dfrac{y_2-y_1}{x_2-x_1}[/tex]

We have the points (1, -1) and (6, 2).

Substitute:

[tex]m=\dfrac{2-(-1)}{6-1}=\dfrac{2+1}{5}=\dfrac{3}{5}=0.6[/tex]

What is the area of a square with a side length of 7 feet ?

HELP

Answers

Answer:

49 square feet

Step-by-step explanation:

Area of square

[tex] = {7}^{2} \\ \\ = 49 \: {ft}^{2} \\ [/tex]

Alysha’s average speed when walking home from the market was 5 mph, and it takes her 21 minutes longer than when she drives to the market. If she drives along the same route, at an average speed that is 8 times her average walking speed, how many minutes does it take her to drive home from the market?

Answers

9514 1404 393

Answer:

  3 minutes

Step-by-step explanation:

Let x represent Alysha's time to drive home from the market.

Speed and time are inversely proportional to each other (for the same distance), so we have ...

  (walking speed)(walking time) = (driving speed)(driving time)

  5(x +21) = (8·5)(x)

  x +21 = 8x . . . . . . . . . divide by 5

  21 = 7x . . . . . . . . subtract x

  3 = x . . . . . . .divide by 7

It takes Alysha 3 minutes to drive home from the market.

Neil is completing a 10 km run in 4 months’
time. His personal best for 10 km is 55 minutes
and he wants to complete this run in less than
45 minutes.

Identify the components of health-related
fitness that Neil will have to develop to try and
achieve this. Justify your choices.

Answers

Answer:

Hello There!!

Step-by-step explanation:

There are five components of physical fitness:

1. Body composition

2.Flexibility

3. Muscular strength

4. Muscular endurance

5. Cardiorespiratory endurance

I think he will have to develop Flexibility,Muscular Endurance and also Cardiorespiratory Endurance.

hope this helps,have a great day!!

~Pinky~

Other Questions
what country has not experienced balkanization? PLS HELP FAST, IM FAILING LOLWhat is true about life under slavery?A. Slave owners discouraged slaves from adopting elements of whitecultureB. Slave owners did not pay slaves for their work,c. Enslaved African Americans had equal rights to those of whitepeopleD. Slaves had a great deal of freedom other than choosing where towork. NEED HELP ASAP DUE 11:30PM ! Which descriptions of the English colonies in North America are accurate?Choose all answers that are correct.Question 46 options:The king granted a lot of self-government to Massachusetts and other colonies in the hope they would send back raw materials and would start paying taxes.The men on the Mayflower signed an agreement to write fair laws for the good of the colony.Virginia planters paid English laborers good wages to come work on their plantations.Jamestown was established on good ground near clean water in a healthy environment.Only about 1 in 5, or 20 percent, of early colonists in Virginia survived Match the expression with an equivalent expression 6( n + 4 ) = Can anyone please help me solve this?? A: x/8=3/4B: 2/5=x/40C: 1/8=x/40D:x/10=12/15 How are modern maps and ancient maps similar?a.They both feature three-dimensional drawings.b.They both rely on art and science for mapmaking.c.They both rely on paper-based drawings of an area.d.They both focus on the physical features of an area. 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) Calculate the volume of 1280 kilograms of aluminium if the density is 2700kg/m3 can you please help me:) What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?Children enjoy the art displays of sea creatures.Many people now look for trash to pick up when they are visiting the beach.Creating artwork can be both beautiful and horrifying.Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.Question 2Part BWhich detail from the text best conveys the answer in Part A?"'It's the only thing he's liked all day,' his grandmother said.""An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art.""All of the art is made from plastic trash that washed ashore, including a great white shark""She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas." Please help 4 questions for 10 points!!!------------------------------------------------------------1) Which expression is equivalent to 4(23)?4(20+3)4(2+3)4(2+13)4(20+30)..................................................................................................2. Which expressions are equivalent to 4(42)?Select each correct answer.4(20+22)4(40+2)4(4+20)4(4+2).......................................................................................................3.Which expression shows how 645 can be rewritten using the distributive property?640+6206+205640+6564+65...............................................................................4.Tori uses the greatest common factor and the distributive property to rewrite this sum:24 + 84What expression does Tori write?2(24+42)12(2+7)24(1+4)4(6+21).....................................................................my last one got deleted.... paid rent of Rs.25000 by cheque. make journal entry Use a number line to order the numbers from least to greatest. HELLLPPPP!!!!! write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! Name the factors in each of the following problems i need help lol i forgot how to do this