Find the area of the circle.
25 yd

Answers

Answer 1
The area of the circle A≈64457.75in²

Related Questions

please help with this question?!

Answers

Answer:

120 yd²

Step-by-step explanation:

The solid has 5 faces.

Bottom: rectangle 6 yd by 3 yd

Left: rectangle 8 yd by 3 yd

Right: rectangle 10 yd by 3 yd

Front & Back: 2 triangles 6 yd base and 8 yd height

area = 6 * 3 + 8 * 3 + 10 * 3 + 6 * 8

area = 72 + 48

area = 120

Answer: 120 yd²

HELP PLEASE ANSWER I NEED HELP

Answers

Answer:

x=30

Step-by-step explanation:

x/5-16=-10

x/5=-10+16

x/5=6

x=6×5

x=30

prove the following identity showing all steps:
[tex]\frac{cos(x+30)-sin(x+60)}{sin(x)cos(x)} =-sec(x)[/tex]

please help fast

Answers

Answer:

See solution below

Step-by-step explanation:

Given the expression

[tex]\frac{cos(x+30)-sin(x+60)}{sin(x)cos(x)} \\[/tex]

Recall that

cos x  = sin(90-x)

cos(x+30 ) = sin (90-(x+30)

= sin(90-x-30)

= sin(60-x)

Substitute

[tex]\frac{sin(60-x)-sin(x+60)}{sin(x)cos(x)} \\= \frac{sin60cosx-cos60sinx)-sinxcos60-cosxsin60)}{sin(x)cos(x)} \\= \frac{-2cos60sinx)}{sin(x)cos(x)} \\= \frac{-2(1/2)sinx)}{sin(x)cos(x)} \\= \frac{-1}{cos(x)}\\= \frac{1}{cos(x)}\\ \\= -sec(x) Proved[/tex]

Can you guys help me find the area of this shape. I've literally tried everything and got it wrong.

Answers

Answer:

110 square centimeters.

Step-by-step explanation:

The area for a trapezoid can be figured out with the equation (a + b)h/2.

(9 * 5) + (9 + 4)10/2 {Work inside the parentheses first.}

45 + (13)10/2 {Divide 10 by 2 to get 5.}

45 + 13(5) {Multiply 13 by 5 to get 65.}

45 + 65 {Add 45 & 65 to get 110.}

110 square centimeters.

The area of the figure is 110 square centimeters.

HELP ASAP
What is the 10th term in the geometric sequence below?


−4, 12, −36, 108, ...


a)-236196


b)-78732


c)236196


d) 78732

Answers

Answer:

78732

Step-by-step explanation:

Pls help with thissss

Answers

10.3 if you divide 43 and 11 you round and get 10.3

What is 2x times 3x............................

Answers

Answer:

What is 2x times 3x

6x

Step-by-step explanation:

3•2=6

Use the quadratic formula to solve for x.
6x²-3x=1
Round your answer to the nearest hundredth.
If there is more than one solution, separate them with commas.

Answers

If we know the quadratic formula, the quadratic formula is

x = [-b ± √(b²- 4ac)] / 2a

Gosh! So overwhelming! But let's look at the composition of a quadratic equation:

ax² + bx + c = 0

And we have 6x² - 3x = 1. So, what do we do? We need to put this quadratic equation into an easy form to find the value of a, b, and c to plug in to the equation.

We can just minus one on both sides to get this:

6x² - 3x - 1 = 0

Is it in the form of ax² + bx + c? Yes! a = 6, b = -3, and c = -1. Now, all we have to do is plug it into the quadratic formula.

x = [-b ± √(b²- 4ac)] / 2a

x = [-(-3) ± √((-3)²- 4(6)(-1))] / 2(6)

     [3 ± √(9- 4(6)(-1))] / 12

     [3 ± √(9 + 24)] / 12

     [3 ± √(33)] / 12

At this point, we should just use a calculator, and recognize we have two answers because of the plus-or-minus sign! (or this sign: ±)

[3 ± √(33)] / 12

1) [3 + √(33)] / 12 = 0.73 approximately

2) [3 - √(33)] / 12 = -0.23 approximately

So, x=0.73 and x= -0.23.

funniest thing you'll see all day

Answers

Answer:

My dog getting smacked allot by my cat ( my cat was bullying my dog all day XD) 1 thanks = one less smack for the dog lol

Step-by-step explanation:

Me kat (cat) was mewing all day. Me go to market to buy his favourite food (fish).Me comes home. Me takes time to prepare fish. Me gives kat fish. He throw away fish and insult me with some more mews

Which of the following describe 9.629? Select all that apply.
whole number
real number
rational number
irrational number

Answers

Answer:

Real number

Rational number

Step-by-step explanation:

Can someone pleaseeee help and if you’re correct i’ll give brainliest

Answers

Answer:

2,827.43

Step-by-step explanation:

PLS HELP ME THIS IS Probability (Single event) PLS HELP ME

Answers

Answer:

2/6  or 33.3%

1/6 or 16.65%

3/6 or 50%

0/6 0r 0%

Step-by-step explanation:

What is the PE of an object that is 15kg that is 5.0 M above the ground?

Answers

Answer:

735 J

Step-by-step explanation:

The potential energy of a body can be found by using the formula

PE = mgh

where

m is the mass

h is the height

g is the acceleration due to gravity which is 9.8 m/s²

From the question we have

PE = 15 × 9.8 × 5

We have the final answer as

735 J

Hope this helps you

Is a trapezoid always a square?

Answers

No it is not trust me you will lean that as a freshmen

Answer:

No

Step-by-step explanation:

A trapezoid is never a square. A trapezoid only has one pair of parallel lines and a square has two.

from edgunuity please help asap! image attached above​

Answers

It’s 4 I hope this helps


Explanation I took this in 9th grade so I know how to do this kind of stuff


Which function is the same as the linear
function represented by the table?
x y
-4 -14
-2 -8
0 -2
2 4
4 10

Answers

Answer:

y=3x-2

Step-by-step explanation:

We know the equation ends in -2 because when x is zero, y is -2

To find the rest of the equation take any other point and take away the -2 from y

Then divide the y by the x to see how may times larger (or smaller) the y is then the x

(I chose -14)

-12÷-4=3

y=3x

the put the -2 back at the end because otherwise, your -14 would be a -12 and that is not a point on the table


The value, V(t), of a baseball card increases according to the function V(t) = P(1.045)', where P is the purchase price of the
baseball card and t is the time, in years since the card was purchased. By what percent does the value of the card increase each
year'?
1 4.5%
2 45%
3 95.5%
4 145%

Answers

The Percentage increase in the purchase price each year is 4.5%.

The given function is:

[tex]V(t)=P(1.045)^t[/tex]

Where P is the purchase price of the baseball card and t is the time.

What is a function?

A function is a rule that establishes a relation between two variables.

[tex]V(1)=P(1.045)^1\\V(1)=1.045P[/tex]

[tex]V(2)=P(1.045)^2\\V(2)=1.092025P[/tex]

Percentage increase in the purchase price each year

=[tex]\frac{V(2)-V(1)}{V(1)} *100[/tex]

[tex]=\frac{1.092025P-1.045P}{1.045P} *100[/tex]

[tex]=4.5%[/tex]%

Hence, the Percentage increase in the purchase price each year is 4.5%.

To get more about functions visit:

https://brainly.com/question/2833285

Two shops sell the same brand of baked beans but in different sizes of tin. Calculate the price of 1 kg of baked beans for each shop. Give your answers in pence.

Answers

Answer:

Shop A = 113 pence

Shop B = 101 pence

Step-by-step explanation:

Given :

Shop A :

5kg for £5.65

Shop B:

2kg for £2.02

Price per kg :

weight / price

100 pence = £1

Shop A :

Price of 1kg :

5.65 / 5 = £1.13 = 113 pence

Shop B:

2.02 / 2 = £1.01 = 1.01 * 100 = 101 pence

A cylinder and a cone are shown below.

-

12 in.

-

12 in.

Volume of cylinder = 2512 in.

Volume of cone = 1256 in.

Which explains whether the bases of the cylinder and the cone have the same area?

O The bases have the same area because the heights are the same.

O The bases have the same area because the volume of the cone is 5 the volume of the cylinder.

O The bases do not have the same area because the volumes are not the same.

O The bases do not have the same area because the volume of the cylinder is not 3 times the volume of the cone, given

the same heights.

Answers

Answer:

The bases do not have the same area because the volume of the cylinder is not 3 times the volume of the cone, given the same heights.

Step-by-step explanation:

Recall :

V1 = volume of cylinder = πr²h

V2 = volume of a cone = 1/3πr²h

From the diagram, both have height, h of 12

Radius = r

V1 = 2512 in

V2 = 1256 in

From the ratio :

2512 = πr² * 12

1256 = 1/3πr² * 12

12 cancel out as well as r² and π

If the bases have the same area `, then 2512 should be equal to (1256 * 3)

2512 in ≠ 3868 in

Answer:

The answer is D

Step-by-step explanation:

I got it right on my unit test

God bless

someone please help thanks!<3

Answers

Answer:

y = -5x + 4/3

Step-by-step explanation:

m is the slope and b is the y intercept. m= -5 so -5 is the slope and b= 4/3 so 4/3 is the y intercept.

which angle is supplementary to.... asap plz

Answers

Angle CGA supplementary angles add up to 180°

Answer:

Angle AGC

Step-by-step explanation:

Two angles are called complementary if their measures add to 90 degrees, and called supplementary if their measures add to 180 degrees. ... For example, a 50-degree angle and a 40-degree angle are complementary; a 60-degree angle and a 120-degree angle are supplementary

Notes for proportional relationships can you give me notes to write down lol

Answers

Answer:

Step-by-step explanation:

Proportional relationships are relationships between two variables where their ratios are equivalent. Another way to think about them is that, in a proportional relationship, one variable is always a constant value times the other. That constant is know as the "constant of proportionality".

Which set of integers is in order from least to greatest? a. 1, -2, 3, 4, -5. b. -5, 4, 3, -2, 1. c. -2, -5, 1, 3, 4 d. -5, -2, 1, 3, 4.

Answers

Answer:

Step-by-step explanation:

Negative numbers have the least value and (-1) is the greatest negative value

So, d is arranged in least to greatest order

d) -5 , - 2 , 1 , 3 , 4

Answer:

The answer is D.

Step-by-step explanation:

D is the one that has the order from least to greatest.

Maisiereceives a weekly paycheck from her boss she spent half of this week paycheck on food and spent and additional 5.00 on a taxi . If she didn't spend any additional money and finished the week with 41 how much is Masie weekly paycheck

Answers

Answer:

If she didn't spend any additional money and finished the week with 41 how much is Masie weekly paycheck. 1. See answer.

Find m
160
260
50
80

Answers

The answer is a 160

Jerry has four jackets in his closet. Without looking, he reached into his closet, pulled out a jacket, and then put it back in the closet. What is the probability that Jerry will randomly select the same jacket a second time?

Answers

Answer:

1%

Step-by-step explanation:

.

Find the surface area of the composite solid. 6 ft 4 ft 1 5 ft 5 ft​

Answers

Sa Of Rectangular Prism - 65

Sa Of Pyramid - 85

TOTAL SURFACE AREA - 150

what is 6/7 of2/3? pls help
\

Answers

Answer:

4/7

Step-by-step explanation:

6/7 ÷ 2/3 = 6/7 * 3/2 = 18/14 --->1 4/14 ---> 1 2/7

Please help me I am doing a test I need to get 100 please help me

Answers

I'm learning this rn i gotchu
for 8 it's b

Helpppp asapppp I’ll give you a lot of points

Answers

Answer:

[tex]x = \frac{5a-2} {7+5a}\\[/tex]

Step-by-step explanation:

Given the expressions

[tex]x = \frac{5}{9y+5}....1\\y = \frac{5}{5a-2} ...2[/tex]

Substitute 2 into 1

[tex]x = \frac{5}{9(\frac{5}{5a-2} )+5} \\x = \frac{5}{(\frac{45}{5a-2} )+5} \\x = \frac{5}{\frac{45+5(5a-2)}{5a-2} } \\x= \frac{5}{\frac{35+25a}{5a-2} }\\x = \frac{5(5a-2)} {35+25a}\\x = \frac{5(5a-2)} {5(7+5a})\\\\x = \frac{5a-2} {7+5a}\\[/tex]

Other Questions
Calculate the specific heat capacity for bone based on the above data. Show your work. there are two machines that can produce aluminum cans. The newer machine can produce 5400 cans in 180 minutes. It takes the older machine 217 minutes produce that many cans. If the two machines work together, how long will it take them to produce 5400 cans? What is the distance between points A and B? Enter your answer, rounded to the nearest tenth, in the box. units The students in two 7th grade classes were asked, "How many text messages did they send over the past weekend?" The data was collected and a dot plot was created for each class. For what values do class A's distribution and class B's distribution overlap? what is an advantage of the scientific method? Help please! No file attachments please, only write your answers in response to question. Across the continent, what obstacles might Americans face as the move west into areas that do not already have settlements? You decide to take your car on a drive through Canada, where gas is sold in liters and distances are measured in kilometers. Suppose your car's gas efficiency is 23.0 mi/gal. How many liters of gas will you need to complete a 495 km trip? Use the conversions 1 gal = 3.78 L and 1 km = 0.6214 mi. L Find the slope!19.) (-3, 4) and (-4,-2) please help me this is confusing please add an explanation to it What if social media was never created? Think about how this would affect you and the world around you. Would this be a positive or negative switch? Be detailed when providing your answer. Olivia has 150 caramel apples to sell. Each caramel apple is covered with one topping. 2/3 of the caramel apples are covered with peanuts. 1/5 are covered with chocolate chips. 1/10 are covered with coconuts. How many caramel apples are covered with sprinkles? What is the author's tone in this line from William Dean Howells's "Editha"?Then Editha's father said in the tone of his public-will-now-address-a-few remarks, "My name is Balcom, maam; Junius Balcom, of Balcom's Works, NewYork. . . ." Hey can you help me fast!! During the Cold War Which 2 superpowers attempted to spread their economic system and influence globallya. USSR and Inidab. Britian and Scotlandc. USA and Canadad. USSR and USA AAAAAUGACCAAAGUGGAGUAAUGGUAACCC please type first 3 letters of each amino acid separated by a dash. Please help. Ill give brainlest!! No links what goes in the highlighted box? The astronomy club has x membersand wants to increase membershipby 25%. Write an expression forthe number of members if the goalis reached. please help! help me do this plz brainiest to whoever right