Factor as the product of two binomials.
x
2
+
3
x
+
2
=
x2+3x+2=x, squared, plus, 3, x, plus, 2, equals

Answers

Answer 1

Answer:

(x+1)(x+2)

Step-by-step explanation:

Answer 2

Answer:

(x-1)(x-2)

Explanation:

To factor x^2-3x+2 as (x+a)(x+b) we need to find number a and b such that a+b=-3 ab=2

Summary of above: (−1)+(−2)=−3

So the integers we are looking for are

−1 and −2

Therefore, x^2-3x+2=(x-1)(x-2)


Related Questions

-3b+7=13 solve for b

Answers

Answer:

b = -2

Step-by-step explanation:

Start with your given:

-3b + 7 = 13

Subtract 7 on both sides:

-3b = 6

Then, divide -3 on both sides and solve:

b = -2

Answer:

b = -2

Step-by-step explanation:

You start by subtracting the 7 on the left and move it to the other side. Then you have 6 on the right and -3b on the left. Then you divide the -3 on each side and that gives you b= -2.

Hope this helps.

Write an equation that is parallel to the line y=3x-5 and passes through the point (-1,2)

Answers

Two lines with same slopes are parallel.
So The slope must be 3.
2=3(-1)+a
a=5
y=3x+5

If a sample mean is 37,which of the following is most likely the range of possible values that best describes an estimate for the population mean?

Answers

Answer:

(32, 42)

Step-by-step explanation:

Answer:

(32,42)

Step-by-step explanation:

1.] What is the probability of choosing a king
from a standard deck of playing cards?

Answers

Answer:

1/13

Step-by-step explanation:

there are 4 kings in a deck of 52 cards.

4/52 = 1/13

The (average) sales price for single family property in Seattle and Port Townsend is tabulated below.



Year Seattle Port Townsend


1970 $38,000 $8,400


1990 $175,000 $168,400



Find a linear model relating the year x and the sales price y for a single family property in Seattle.

Answers

Answer:

[tex]y=6,850x - 13,456,500[/tex]

Step-by-step explanation:

To find the linear model, we need to find a linear equation, where its slope is defined as

[tex]m=\frac{y_{2} -y_{1} }{x_{2}-x_{1} }[/tex]

So, we use the given points (1970, 38000) and (1990, 175000), to find the slope

[tex]m=\frac{175,000-38,000}{1990-1970}=\frac{137,000}{20} =6,850[/tex]

Now, we use the point-slope formula to find the equation

[tex]y-y_{1} =m(x-x_{1} )\\y-38000=6850(x-1970)\\y=6850x-13,494,500+38,000\\y=6,850x - 13,456,500[/tex]

Therefore, the linear model is

[tex]y=6,850x - 13,456,500[/tex]

Two forces are acting on an object at the same point. Determine the angle between the two forces. (-2,7) and (3,-1)

Answers

The answer is 56 degree

Answer:

It is 124 degrees.

Step-by-step explanation:

You square each coordinate like this:

sqrt(x^2+y^2 )

You will end up getting sqrt(53 and sqrt(10.

Then find the dot product which is -6+-7=-13.

Then cos^-1(-13/sqrt53*sqrt10)

=124 degrees

One brand of coffee is packaged in cylinders where the height is equal to the radius, r. The volume of the package, in cubic centimeters, can be found using the function V(r) = πr3. The number of ounces of coffee in the cylinder depends on the volume of the cylinder, V, in cubic centimeters. This can be modeled by the function C(V) = 3.2V. Which function can be used to find the number of ounces of coffee in the can based on its radius? C(V(r)) = 32.768πr3 C(V(r)) = 3.2πr3

Answers

Answer:

C(V(r)) = 3.2πr3

Step-by-step explanation:

This problem is a composition of function defined by C(V(r)), now we have the functions [tex]V(r)= \pi r^{3}[/tex] and [tex]C(V)=3.2V[/tex], where the first depends on the radius, and the second dependes on the volume, that means, to find the number of ounce of coffe, we need to determine the volume of the cylinder, that's why we have to replace the volume function inside the ounces function,

[tex]C(V(r))=3.2(\pi r^{3} )[/tex]

Therefore, the right answer is the last choice.

A chessboard has 64 squares. George places 1 grain of rice on the first square, 2 grains on the second square, 4 grains on the third square, 8 grains on the fourth square, and so on, until he has placed grains of rice on 10 squares.
Once George has put rice on the 10th square, he has placed a total of _____ grains of rice on the chess board.

Answers

Hey there! I'm happy to help out!

As you can see, our number keeps on doubling. It's like 2×2×2×2.... so on and so forth. Whenever we multiply a number by itself, we can model it as an exponent, so if we had 2², it is two twos being multiplied, and 2×2=4. If it was 2³, it would be 2×2×2=8.

However, we have a one. This signifies a starting point and exponents have our back. Anything to the 0th power is always equal to one! So, this situation would look something like this:

[tex]2^0, 2^1, 2^2, 2^3,2^4,... etc.[/tex]

So, for the second square, we are going to the first power. For the fourth square it's going to the third power. Therefore, the 10th square will be the 9th power!

[tex]2^9=[/tex] 2×2×2×2×2×2×2×2×2= 512

However, we want to find how much he has done in total! So, let's find how much he did on the other squares!

[tex]2^8[/tex]= 256

[tex]2^7[/tex]=128

[tex]2^6[/tex]=64

[tex]2^5[/tex]=32

[tex]2^4[/tex]=16

2³=8

2²=4

[tex]2^1[/tex]=2

[tex]2^0[/tex]=1

Now, we add these all up to find the total grains of rice!

512+256+64+32+16+8+4+2+1=895

Therefore, George has placed a total of 895 grains of rice on the chess board.

I hope that this helps! Have a wonderful day!

Once George has put rice on the 10th square, he has placed a total of 1023 grains of rice on the chessboard.

What is a geometric sequence?

A geometric sequence is a sequence of numbers in which the ratio between consecutive terms is constant.

We have,

On the first square, George placed 1 grain of rice.

On the second square, he placed 2 grains.

On the third square, he placed 4 grains.

On the fourth square, he placed 8 grains.

In general, on the nth square, he places [tex]2^{n-1}[/tex] grains.

So,

On the first 10 squares,

1 + 2 + 4 + 8 + ... + [tex]2^9[/tex]

This is a geometric series with a first term of 1 and a common ratio of 2.

The sum of the first n terms of a geometric series.

[tex]S_n[/tex] =[tex]a(1 - r^n) / (1 - r)[/tex]

where a is the first term, r is the common ratio, and n is the number of terms.

Substituting the values,

[tex]S_{10}[/tex] = 1(1 - 2^10) / (1 - 2)

    = 1(1 - 1024) / (-1)

    = 1023

Therefore,

Once George has put rice on the 10th square, he has placed a total of 1023 grains of rice on the chessboard.

Learn more about geometric sequence here:

https://brainly.com/question/2321576

#SPJ7

Please help asap! Will give brainliest! Please read the question then answer correctly! No guessing.

Answers

Answer:

(x - 5) (x - 7)

Step-by-step explanation:

To factor this trinomial, you must split the middle term (-12x) into two terms that can be added to get -12x, and multiplied to get 35:

[tex]x^2[/tex] - 12x + 35

[tex]x^2[/tex] -7x - 5x + 35

Group:

([tex]x^2[/tex] -7x) (-5x + 35)

Take out the GCF (Greatest Common Factor):

x(x - 7)  -5(x - 7)

(x - 5) (x - 7)

Answer:

the answer is D

Step-by-step explanation:

x^2-12x+35=x^2-7x-5x+35=x*(x-7)-5(x-7)=(x-7)(x-5)

The vertices of ΔDEF have coordinates D(–1, 2), E(3, 3), and F (2, –4).What are the coordinates of the vertices of r(90°, O)(ΔDEF)?

Answers

Answer:

D,E

Step-by-step explanation:

hope I helped



If V = 15 cm, W = 20 cm, X = 25 cm, Y = 7 cm, and Z = 22 cm, what is the perimeter of the object?
A.
53 cm
B.
64 cm
C.
118 cm
D.
78 cm

Answers

Answer:

Sum of all the sides.

Step-by-step explanation:

Perimeter is the sum of the distance in length or width, or height or circumference of all the sides of an object.

Therefore the sum total of the given sides V, W, x ,Y, Z are;

15 +20 + 25 + 7 + 22 = 89cm

Since a picture isn't available to know which sides of the objects can be added.

How do you determine similarities in shapes?

Answers

Answer:

Step-by-step explanation:

. if every corresponding internal angles in both shapes are equal

. if all corresponding sides are equal or have same ratio.

more rules but depends on the shape also ( triangle, rectangle, hexagon,...)

The formula A=12(b+c)h. Write the equation in term of c?

Answers

Answer:

[tex]c = \frac{A}{12h} - b[/tex]

Step-by-step explanation:

Okay, so the goal is to isolate c on one side with all the other terms on the other side. So, let's start by dividing both sides with 12h. After we do that, we will be left with [tex]\frac{A}{12h} = b+c[/tex]. Now, we can subtract both sides by b, and we will be left with [tex]\frac{A}{12h} - b = c[/tex]. Yay! We've now isolated c and that is our final answer!

Hope this helped! :)

Tell the measure of the angles In degrees 1/4

Answers

Answer:

so 1/4 of a circle is 90 degrees 1/4 is equal to 90 over 360 C it's 90 parts of 360. so here we go with this one. this angle is 20 degrees remember that's 90 alright the square one and this little part would be 20 degrees each angle appears wider as the Rays get longer.

Step-by-step explanation:

Let me know if this help's you lol :)

The measure of 1/4 is 90°

Kelly needs 1/8 cups of sugar to make 1/4 of her cookie recipe. How much sugar does she need to make the entire recipe?

Answers

Answer:

1/2 cup of sugar

Step-by-step explanation:

She needs to multiply 1/8 cup of sugar by 4 to make the entire recipe since 18 cup of sugar is only good for a fourth of the recipe.

Suppose r⃗ (t)=cos(πt)i+sin(πt)j+5tkr→(t)=cos(πt)i+sin(πt)j+5tk represents the position of a particle on a helix, where zz is the height of the particle. (a) What is tt when the particle has height 2020? t=t= (b) What is the velocity of the particle when its height is 2020? v⃗ =v→= (c) When the particle has height 2020, it leaves the helix and moves along the tangent line at the constant velocity found in part (b). Find a vector parametric equation for the position of the particle (in terms of the original parameter tt) as it moves along this tangent line.

Answers

Answer:

a) t = 4

b) v = pi j + 5 k

c) rt = 1i + (pi t) j + (20 +5t )k

Step-by-step explanation:

You have the following vector equation for the position of a particle:

[tex]r(t)=cos(\pi t)\hat{i}+sin(\pi t)\hat{j}+5t\hat{k}[/tex]    (1)

(a) The height of the helix is given by the value of the third component of the position vector r, that is, the z-component.

For a height of 20 you have:

[tex]5t=20\\\\t=\frac{20}{5}=4[/tex]

(b) The velocity of the particle is the derivative, in time, of the vector position:

[tex]v(t)=\frac{dr(t)}{dt}=-\pi sin(\pi t)\hat{i}+\pi cos(\pi t)\hat{j}+5\hat{k}[/tex]    (2)

and for t=4 (height = 20):

[tex]v(t=4)=-\pi sin(\pi (4))\hat{i}+\pi cos(\pi (4))\hat{j}+5\hat{k}\\\\v(t=4)=-0\hat{i}+\pi\hat{j}+5\hat{k}[/tex]

(c) The vector parametric equation of the tangent line is given by:

[tex]r_t(t)=r_o+vt[/tex]      (3)

ro: position of the particle for t=4

[tex]r_o=cos(\pi (4))\hat{i}+sin(\pi (4))\hat{j}+20\hat{k}\\\\r_o=\hat{i}+0\hat{j}+20\hat{k}[/tex]

Then you replace ro and v in the equation (3):

[tex]r_t=(1\hat{i}+20\hat{k})+(\pi \hat{j}+5\hat{k})t\\\\r_t=1\hat{i}+\pi t \hat{j}+(20+5t)\hat{k}[/tex]

Part(a): The value of [tex]t=4[/tex]

Part(b): Required vector [tex]L(t)=(1\widehat{i}+0\widehat{j}+10\widehat{k})+(t-4)(0\widehat{i}+\pi \widehat{j}+5\widehat{k})[/tex]

Given vector equation is,

[tex]r(t)=cos(\pi t)\widehat{i}+sin(\pi t)\widehat{j}+5t\widehat{j}[/tex]

Vector equation:

A vector is an object that has both a magnitude and a direction. Geometrically, we can picture a vector as a directed line segment, whose length is the magnitude of the vector, and with an arrow indicating the direction.

Part(a):

When the particle has a height of 20

[tex]5t=20\\t=4[/tex]

Part(b):

The point on the curve is [tex](cos(4\pi),sin(4\pi),20) =(1,0,20)[/tex]

Differentiating the given equation with respect to [tex]t[/tex].

[tex]r'(t)=- \pi sin(\pi t)\widehat{i}+\pi cos(\pi t)\widehat{j}+5\widehat{k}\\r'(t)=- \pi sin(4\pi t)\widehat{i}+\pi cos(4\pi t)\widehat{j}+5\widehat{k}\\r'(4)=0\widehat{i}+\pi \widehat{j}+5\widehat{k}\\L(t)=r(4)+(t-4)r'(4)\\L(t)=(1\widehat{i}+0\widehat{j}+10\widehat{k})+(t-4)(0\widehat{i}+\pi \widehat{j}+5\widehat{k})[/tex]

Learn more about the topic Vector equation:

https://brainly.com/question/24906745

1. Terry made $53
washing cars. She made
some money selling
cookies. In total she has
$67. How much money
did she make selling
cookies?​

Answers

Answer:

Terry made $14 selling cookies.

Step-by-step explanation:

[tex]67-53=14[/tex]

Answer:

$14

Step-by-step explanation:

She made $14 selling cookies.

$67-$53=$14

Solve for a,b,and/or c
Help solve ASAP!

Answers

Answer:

a=90-67=23°

.................

Find the area of the triangle

Answers

Answer:

84mm

Step-by-step explanation:

Formula of a triangle:

A =bh/2

A=14(12)/2

A=168/2

A=84mm

The table shows the number of cups of water required when cooking different amounts of rice.

Amount of
Rice
(cups) Amount of
Water
(cups)
2 5
3 7.5
5 12.5
8 20
Which statements apply to the ratio of rice and water? Choose two options.

The amount of rice is the dependent value.
The amount of water is the dependent value.
The amount of rice is the independent value.
The amount of water is the independent value.
The values cannot be labeled as dependent or independent without a given equation

Answers

Answer:

The amount of water is the dependent value.The amount of rice is the independent value.

Step-by-step explanation:

The wording "the amount of water required for different amounts of rice" suggests that the "output" value of the table is the amount of water, and the "input" value is the amount of rice.

That makes "water" the dependent variable, and "rice" the independent variable.

  The amount of water is the dependent value.

  The amount of rice is the independent value.

Answer:

The amount of water is the dependent value.

The amount of rice is the independent value.

Step-by-step explanation:

What are the roots of y = x2 – 3x – 10?
0-3 and -10
-2 and 5
X 2 and -5
3 and 10

Answers

Answer:

x = 5      x = -2

Step-by-step explanation:

y = x^2 – 3x – 10

Set the equation equal to zero

0= x^2 – 3x – 10

Factor

What 2 numbers multiply to -10 and add to -3

-5 *2 = -10

-5+2 = -3

0=(x-5) ( x+2)

Using the zero product property

x-5 = 0    x+2 = 0

x = 5      x = -2

Answer:

-2 and 5

Step-by-step explanation:

trust

Assume the average weight of an American adult male is 180 pounds with a standard deviation of 34 pounds. The distribution of weights follows a normal distribution. What is the probability that a man weighs somewhere between 120 and 155 pounds?

Answers

Answer:

Step-by-step explanation:

Find a-score of both

z-score = (x-mean)/SD

for 120

z =( 120- 180)/34 = -1.765

For 155

z = (155-180)/34 = -0.735

The probability to look for using z-score table is;

P(-1.765<z<-0.735) = 0.19239


A bookstore had 60 copies of a magazine. Yesterday, it sold 1/3 of them. Today, it sold 1/4 of what remained. How many copies does the bookstore have left?

Answers

Answer:

30

Step-by-step explanation:

1/3 of 60 is 20

40 would be left

1/4 of 40 is 10 so 30 would be left

Which of the following are perfect squares? Check all that apply.

Answers

Answer: 16, 64, and 49

Step-by-step explanation: Perfect squares are products made by squaring or multiplying a whole number by itself twice.

11 is not a perfect square since nothing can

be multiplied by itself to give us 11.

The same is true for 62 and 15.

16 is a perfect square since it's possible to find a whole number that can be multiplied by itself to give us 16.

That number is 4 since 4 × 4 = 16.

64 is also one since 8 can be multiplied by itself twice to give us 64.

49 is also one since 7² or 7 × 7 is 49.

Answer:D,E and F

Step-by-step explanation:

Perfect squares are numbers in which their square roots are whole numbers.

From the options

√16 =4

√64 =8

√49 =7

A child is laying on the ground relaxing and looking up at a plane that is passing by. If the plane’s altitude is 33,500 feet and the child’s eyes are located 8,200 feet away from a point on the ground directly beneath the plane, what is the angle of elevation for the child’s line of sight to the plane?

Answers

Answer:

  about 76.2°

Step-by-step explanation:

The geometry can be modeled by a right triangle with the given dimensions being the side opposite the angle (height = 33,500 ft) and the side adjacent to the angle (8,200 ft). The fact that you know these two sides suggests the inverse of the tangent function may be useful.

  Tan = Opposite/Adjacent

  tan(angle) = (33,500/8,200)

  angle = arctan (335/82) ≈ 76.246°

The angle of elevation is about 76.2°.

Classify each representation shown below as either linear or exponential.

x y
0 5
1 7.5
2 11.25


y = 2x + 4



One person sends an email to 2 people. Those 2 people send it to 4 people, and those 4 send it to 8 people.



Answers

1. Exponential

2. Linear

3. Exponential

Distance between (-1,0) and (8,6)

Answers

Answer:

3 √ 13

Step-by-step explanation:

Answer:

3√13

Step-by-step explanation:

We want to find the distance between these two points. To do so, we need to use the distance formula which states that the distance between two points [tex](x_1,y_1)[/tex] and [tex](x_2,y_2)[/tex] is:

d = [tex]\sqrt{(x_1-x_2)^2+(y_1-y_2)^2}[/tex]

Here, [tex]x_1=-1,x_2=8,y_1=0[/tex], and [tex]y_2=6[/tex]. So:

d = [tex]\sqrt{(x_1-x_2)^2+(y_1-y_2)^2}[/tex]

d = [tex]\sqrt{(-1-8)^2+(0-6)^2}=\sqrt{(-9)^2+(-6)^2} =\sqrt{81+36} =\sqrt{117} =3\sqrt{13}[/tex]

Thus, the answer is 3√13.

~ an aesthetics lover

12 divided by 9 tenths and hundredths

Answers

1.333 the answer I hope help

Given: 5(x + 2) - 3 = 4(x - 1)

Prove: x = -11

Statement Reason
5(x + 2) - 3 = 4(x - 1) given
5x + 10 - 3 = 4x - 4 [?]
5x + 7 = 4x - 4 addition
5x = 4x - 11 subtraction
x = -11 subtraction

Answers

Answer:-11 proved

Step-by-step explanation:

5(x+2)-3=4(x-1)

Open brackets

5x+10-3=4x-4

Collect like terms

5x-4x=-4+3-10

x=-11

arc length of a half of a circle with radius of 9

Answers

Answer:28.26

Step-by-step explanation:

Φ=180 since it's in a straight line

Radius=r=9

π=3.14

Length of arc=Φ/360 x 2 x π x r

Length of arc=180/360 x 2 x 3.14 x 9

Length of arc=0.5 x 2 x 3.14 x 9

Length of arc=28.26

Other Questions
can anybody give me some options and some tips for my portfolio poem. for school. free verse poem. Take 2 y2 - 3 y - 5 from y3 - 6 y2 + 5 y . Select the correct answer.A) y3 - 2 y2 + 3 y + 5B) y3 - 4 y2 + 2 y - 5C) y3 - 4 y2 + 2 y + 5D) y3 - 8 y2 + 8 y + 5 How many Liters are in 17.3 moles of Iron? What is the volume of a rectangular prism with a length of 2 inches, a width of an inch & is a quarter of an inch in height? Is the below sequence DNA or RNA? How do you know?GTTTACAGGCGGCGCAATATCTGATCG Identify the vertex of the function graphed below.A. (1,2)B. (2,-1)C. (3,-2)D. (0,7) In the 1994 elections, Republicans won a clearmajority in states. The landform pictured above is _____, which has formed out of _____ and _____.O A. a glacier, snow; iceB. a glacier; ocean water, snowO C. a mountain; snow; iceOD. an iceberg; ocean water, snow Help asap!!! GIVING BRAINLIST cual es la actitud de las personas de ua comunidad del mundo hispanoblante que te sea familiar con respecto a las personas que se visten de una forma diferente? Which characteristic of the father had the MOST influence on the action of the plot?A)angerB)courageC)fearD)gratitude A pink crayon is made with 12\text{ mL}12 mL12, start text, space, m, L, end text of red wax for every 5\text{ mL}5 mL5, start text, space, m, L, end text of white wax Can you help me please What was the effect of Thomas Paine's pamphlet Common Sense?A. It argued that women should be given the right to vote.B. It persuaded colonists to abolish slavery.C. It explained the benefits of westward expansion.D. It encouraged colonists to fight for independence. 1. Summarize the scientific information that leads to conservation in each of the articles.2. What social issues affected the problem or its solution in each of the stories?3. How did economics delay scientists' first attempts for conservation in each story?4. Describe the political actions that led to successful conservation in both stories. Which trend in hominid evolution can be supported by fossil evidence?Walking uprightUse of toolsIncreased intelligenceDecorating cave walls Find the hypotenuse of each Isosceles right triangle when the legs are of the given measure.Given = 6squareroot2 Select the correct navigational path to create the function syntax to use the IF function.Click the Formula tab on the ribbon and look in the ???'gallerySelect the range of cells.Then, begin the formula with the ????? click ?????. and click OK.Add the arguments into the boxes for Logical Test, Value_if_True, and Value_if_False. A bag contains 4 red, 2 blue, 6 green, and 8 white marbels. Round anwsers to the nearest tenth. What is the probibility of selecting a green marble, replacing it, and then selecting a red marble. please help i don't get it