explain the gaseous exchange in lungs

Answers

Answer 1

Answer:

Gas exchange is the delivery of oxygen from the lungs to the bloodstream, and the elimination of carbon dioxide from the bloodstream to the lungs. It occurs in the lungs between the alveoli and a network of tiny blood vessels called capillaries, which are located in the walls of the alveoli.

Hope it helped u if yes mark me BRAINLIEST!

Tysm!

Answer 2

Answer:

breathing allows the exchange between 2 gases: oxygen and carbon dioxide. Gas exchange occurs in millions of lung alveoli and the capillaries that surround them

Explanation:


Related Questions

The image shows groundwater zones. Top to bottom: Porous rock or soil, Water, Impermeable rock. Zone 1 is at the top of porous rock. Zone 2 is between porous rock and water. Zone 3 is in the Water. Zone 4 is between the Water and Impermeable rock. Which is the saturated zone?

Answers

Answer:

zone 3

Explanation:

Answer:

C

Explanation:

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

What is a pedigree? Please choose the correct answer from the following choices, and then select the submit answer button.
a) a tool to document harmful traits only
b) a type of family tree that can help answer questions about genes and their inheritance patterns
c) a cross between animals other than humans
d) a type of genetic test to determine probability of inheritance
e) a way of following genotypes that are the same as the phenotype

Answers

Answer:

b

Explanation:

A pedigree is a genetic representation of a family tree that diagrams the inheritance of a trait or disease though several generations

Answer:

B

Explanation:

Which statements accurately describe the roles of water on earth

Answers

Answer:

C.

Explanation:

It carries cold water from the equator to the poles

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

The dark organelles labelled E is called the Ribosomes.

Answer:

C

Explanation:

Edge 2020

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

Write TRUE or FALSE
(a)
A 'system' is the part of an organism that carries out a certain function.​

Answers

Answer:

TRUE

Explanation:

True or False: Polar molecules do not have a difference in electrical charge.

Answers

Answer:

false

Explanation:

nonpolar molecule has no separation of charge, so no positive or negative poles are formed

When human skin suffers a cut, the process of healing rapidly begins allowing for wound closure and healing within a few days. Keloids occur when skin around wounds continues to grow after the skin has healed. A disruption in the regulation of which cellular process is probably responsible for this condition

Answers

Options

A. Mitosis

B. Meiosis

C. Apoptosis

D. Phagocytosis

Answer:

A

Explanation:

Mitosis is a type of cell division which takes place in living  organism during growth and development.Therefore it is ensures  the regenerations of cells and tissues during healing.

Therefore the restoration of new cells to the skin following injuries is due to mitosis.Since this is a multiplication division(2n) in which the daughter cells are exactly like the parents' cells the new tissues of the skin by mitosis, look exactly like the previous one that was injured.

In cases where the mitotic growth control is lost, the scare tissues of the injured part overgrows with granulation tissues and this leads to Kaloids.

      Its is a mass of Collagen Type 1.(Collagen is an  fibrous proteins  which has largest proportion in mammals).

Keloids  is characterized with pink or red coloration and elevation of the area,excessive growth of the area, with irritating  patch skin

Is there just one universal scientific method?

Answers

Answer:

There is no such unique standard method—scientific progress requires many methods—but students in introductory science courses are taught that `The Scientific Method' is a straightforward procedure, involving testing hypotheses derived from theories in order to test those theories.

Explanation:

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

Which statement is always true when describing sex-linked inheritance? It results in a dominant trait. The alleles are found on the X or Y chromosome. The resulting trait is influenced by multiple alleles. It is affected by alleles on at least three different chromosomes.

Answers

Answer:

the second one

Explanation:

there are only 2 sex linked chromosomes and that is X and Y

The true statement when describing sex-linked inheritance is ; ( B ) The alleles are found on the X and Y chromosome

The alleles responsible for reproductive inheritance from parents to offspring is contained in the X and Y chromosome of the reproductive gametes.

The female gametes contains double X chromosomes while the male reproductive gametes contains one X and one Y chromosomes. The alleles that are responsible for inheritance ( i.e. the sex of the offspring ) are contained in this chromosomes.

Hence we can conclude that The true statement when describing sex-linked inheritance is the alleles are found on the X and Y chromosome.

Learn more : https://brainly.com/question/24395447

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me


1. If the temperature of the water increases from 5°C to 10°C, the goldfish in Population 1 would most likely

Answers

Answer:

hot water make it hard for fish to breathe

Explanation:

an increase in temperature of water will  reduced the dissolved oxygen in water and increase the metabolic rate of goldfish thus causing goldfish respiration rate

En la raza de ovejas Rommey Marsh, un gen conocido como gris letal, provoca que el feto gris GG, muera antes de las 15 semanas de gestación; El Genotipo heterocigótico Gg produce lana gris y el genotipo homocigótico gg produce lana negra. Si se cruzan individuos heterocigóticos. Cuáles serán las proporciones fenotípicas esperadas en la progenie viva? *

Answers

Answer

1:2:1

Please  check the file,due to technical reasons there was issues  with submission

Explanation:

what mode of nutrition is house fly​

Answers

Answer:

Houseflies do not have chewing mouthparts like a cockroach or piercing-sucking mouthparts like a mosquito. They regurgitate digestive enzymes, soften and liquify the food material, and then they sop it up with their sponging mouthparts.

Hope this makes sense and helps

Which structure is located between the trachea and a bronchiole? A. epiglottis B. pharynx C. alveolus D. bronchus

Answers

the correct answer is the bronchus

what type of cash crops have been genetically modified..... please help!!!!!

Answers

Answer:

Most food modifications have primarily focused on cash crops in high demand by farmers such as soybean, corn, canola, and cotton. Genetically modified crops have been engineered for resistance to pathogens and herbicides and for better nutrient profiles.

Explanation:

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

3. Why are some potentially
renewable resources currently
nonrenewable resources?

Answers

Some potentially renewable resources are currently nonrenewable because... species are taken faster than they can reproduce.

1. ____Bacteria are the only microorganisms used in the fermentation process 2. ____Fermentation can be used only to make dairy products 3. ____Starter cultures are used to initiate the process of fermentation in modern day food processing 4. ____Fermentation occurs when undesirable metabolic reactions allow for the growth of pathogens or the presence of unwanted microorganisms in food

Answers

Please sort the following statements as being true or false regarding fermentation and its role in food production. Please recall the role that microorganisms can play in the production of foods.

Answer:

1.  False statement

2.  False statement

3.  True statement

4.  False statement

Explanation:

1. Yeast is a microorganism which is also used in fermentation process.

2. Fermentation can however be used for various reasons, including: development of flavours, preservation and enrichment of foods, reduction of food cooking time etc.

3. Starter culture is considered to be a form of microbiological process which is used to initiate a process of fermentation.

4. Fermentation is considered to be a desired action of microorganisms

Statement that Bacteria are regarded as only microorganisms utilized in fermentation process is False

Statement that Fermentation is considered only when making dairy products is False.

Statement that Starter cultures can be utilized when initiating the fermentation process in food processing in this age is True.

Statement that Fermentation takes place when growth of pathogens or unwanted microorganisms in food are allowed by undesirable metabolic reactions is False.

Fermentation can be regarded as metabolic process whereby  organism converts a carbohydrate into alcohol or an acid.

This process is used in making dairy products, one of the organisms that can be used in fermentation is yeast.

Learn more at:

https://brainly.com/question/13050729?referrer=searchResults

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

PLEASE ANSWER ASAP!!!!!!!! ITS DUE IN 5 MINUTES.

1.) How do organisms benefit from Mitosis? Write a paragraph using at least five sentences.


Answers

Answer:

Organisms benefit from mitosis because mitosis helps regenerate cells. This helps them recover from injuries and more.

Explanation:

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

Which of the following is a testable hypothesis?
a. Roses are more beautiful than violets.
b. A plant needs at least five hours of sunlight per day to grow.
c. I've cream is delicious.
d. Humans will someday land on Mars.

Answers

Answer:

D. Humans will someday be on mars

nope, the only one you can test would be B, because the others are opinions or something in the future

Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

The dark organelles labelled E is called the Ribosomes.    

The answer is Ribosomes
Other Questions
This table represents a quadratic function.yx014110.52836.5456.5What is the value of a in the function's equation?A.2B.1/2C.-1/2D.1 Sager Industries is considering an investment in equipment that will replace direct labor. The equipment has a cost of $1,200,000 with a $300,000 residual value and a 10-year life. The equipment will replace three employees who has an average total wages of $180,000 per year. In addition, the equipment will have operating and energy costs of $7,500 per year. Determine the average rate of return on the equipment, giving effect to straight-line depreciation on the investment. Consider the function represented by 9x + 3y = 12 with x as the independent variable. How can this function bewritten using function notation?O FID = - vO f(x) = - 3x + 4Of(x) = -x +O fly) = -34+4 how are different religions interdependent? The distance of planet Mercury from the Sun is approximately 5.8. 107 kilometers, and the distance of planet Venus from the Sun is 1.1. 10 kilometers. About how many more kilometers is thedistance of Venus from the Sun than the distance of Mercury from the Sun? What indigenous people lived inCentral America help me please and thank uWhat plans do you have for after high school?And how might Kipp through college be about to help you make those plans into a reality? please help me with this Which of these vegetables can erase pen marks?Cucumbers Mushrooms, garlic, onions Can someone help me, please? Orbit Services, Inc. pays $ 760 ,000 to acquire 30% (200,000 shares) of the voting stock of State Investments, Inc. on January 5, 2019. State Investments, Inc. declares and pays a cash dividend of $ 1.40 per share on June 14, 2019. What is the correct journal entry for the transaction on June 14, 2019? A machine fills 680 bottles in 5hours how many bottles will it fill in three hours? find the unknown angles A person collected $700 on a loan of $600 they made 5 years ago. If the person charged simple interest, what was the rate of interest? The interest rate is %. (Type an integer or decimal rounded to the nearest hundredth as needed.) Find xA. 33B. 443C. 332D. 113 Lori works as a cartoonist for a teen magazine. The time she spends sketching is given by the equation m = 12s, where m is the number of minutes and s is the number of sketches.If Lori made of a sketch, she spent minutes sketching. What infamous political group did adolf hitler lead Please help!Without the discovery of magnetic reversals recorded on the ocean floor, scientistsA. could not confirm the usefulness of sonarB. could destroy the hypothesis of continental driftC. could not provide a mechanism for moving continentsD. could explain how the seafloor was being destroyed Select the correct answer. Which is the best example of a primary source document useful in the study of history? A. a documentary with expert analysis of the event in question B. a peer-reviewed article written about the event by a respected historian C. a professorial analysis of key battlefield strategies of the event D. a journal excerpt from a person involved in the event in question What does the tape measure say Measurement # 3 is? *