Explain any TWO (2) principles of bureaucracy
according to Max Weber.​

Answers

Answer 1

Answer:

Max Weber bureaucratic theory

Max Weber, a German scientist, defines bureaucracy as a highly structured, formalized, and also an impersonal organization. He also instituted the belief that an organization must have a defined hierarchical structure and clear rules, regulations, and lines of authority which

Explanation:

Max Weber bureaucratic theory

Max Weber, a German scientist, defines bureaucracy as a highly structured, formalized, and also an impersonal organization. He also instituted the belief that an organization must have a defined hierarchical structure and clear rules, regulations, and lines of authority which


Related Questions

In Hamdan v. Rumsfeld , the U.S. Supreme Court held that detainees in Guantanamo:____.
a. ​deserved some due process and that the military commissions created at the time were not sufficient.
b. ​did not deserve some due process and that the military commissions created at the time were sufficient.
c. ​did not deserve some due process and the military commissions created at the time were not sufficient.
d. ​deserved some due process and that the military commissions created at the time were sufficient.

Answers

Answer:

c

Explanation:

19. To bring a derivative suit, a shareholder must own stock at the time of the
A. injury and at the time of the suit.
B. injury only
C. suit only
D. trial, suit, and injury

Answers

Answer:

A. injury and at the time of the suit.

Explanation:

A corporation can be defined as a corporate organization that has facilities and owns or controls assets used for the production of goods and services in at least one country other than its headquarter (home office) located in its home country.

This ultimately implies that, a corporation is a corporate organization that owns or controls its business in two or more countries.

One of the advantage of a corporation is that, owners have limited liability for debt to the extent to which they have invested and as such are not personally liable for some of the debt owed by corporation.

A derivative suit can be defined as a lawsuit that's brought forward by a shareholder on behalf of a corporation, to either defend or enforce a legal right (claim) against a third party such as a director or executive officer in the corporation.

Hence, to bring a derivative suit to a court of competent jurisdiction, a shareholder must own stock at the time of the injury and at the time of the suit.

Please answer this question with two sentences. Ill give brainliest to whoever answers correctly with 2 sentences!

Answers

This is protected under the first amendment. When a flag is privately owned, the owner should be able to burn it if the owner chooses, especially if this action is meant in the form of protest. Congress responded to the Johnson decision by passing a Flag Protection Act, only to see the Supreme Court reaffirm Johnson by the same 5–4 majority in United States v. Eichman, declaring that flag burning was constitutionally protected free speech.

juvenile means what?

Answers

Answer: A "juvenile" is a person who has not attained his eighteenth birthday, and "juvenile delinquency" is the violation of a law of the United States committed by a person prior to his eighteenth birthday which would have been a crime if committed by an adult.

please give brainlest if this helps!

In criminal justice systems a youth detention center, known as a juvenile detention center (JDC), juvenile detention, juvenile hall, or more colloquially as juvie/juvy, also sometimes referred as observation home or remand home is a prison for people under the age of 21, often termed juvenile delinquents, to which they ...

The petitioner is the party against whom a petition is filed, especially one on appeal.

A.) True
B.) False

Answers

Answer: I believe its false

Explanation:

Which of the following actions is illegal for selling alcohol

Answers

Answer:

no options

Explanation:

I’m not sure what the options are but reselling alcohols in some states in the United States is in fact illegal.

____ and ____ are the two forms of contracts.

Answers

Answer:

fixed price contracts and cost-reimbursement contracts

WHAT CRIMES ARE COMMITTED BY BOTH MEN AND WOMEN (give 5 crimes)

Answers

, murder, robbery, assault, kidnapping.

Answer:

1. Embezzlement

2. Domestic Violence

3. Murder

4. Car Theft

5. Extortion

Explanation:

What is element identification in the legal practice?

Answers

Answer:

this is what I found online:

"Element Identification is a helpful skill to decide what action is needed…… (IE levels of research via sources and or investigation.) By taking each legal situation and breaking. From this point you may begin identifying the. legal issue of the complaint/case."

Brown v. Board, Main points, argument, and violations. I am expecting a decent paragraph! (10 Sentence!) Majority Opinion for the brief also!

Answers

Answer:

The Supreme Court's opinion in the Brown v. Board of Education case of 1954 legally ended decades of racial segregation in America's public schools. Originally named after Oliver Brown, the first of many plaintiffs listed in the lower court case of Brown v. Board of Education of Topeka, KS, the landmark decision actually resolved six separate segregation cases from four states, consolidated under the name Brown v. Board of Education. While the attorneys originally argued the cases on appeal to the Court in 1952, the featured document, School Segregation Cases - Order of Argument, offers a window into the three days in December of 1953 during which the attorneys reargued the cases.

A reargument was necessary because the Court desired briefs from both sides that would answer five questions, all having to do with the attorneys' opinions on whether or not Congress had segregation in public schools in mind when the 14th amendment was ratified. The document lists the names of each case, the states from which they came, the order in which the Court heard them, the names of the attorneys for the appellants and appellees, the total time allotted for arguments, and the dates over which the arguments took place.

The first case listed, Briggs v. Elliott, originated in Clarendon County, South Carolina, in the fall of 1950. Harry Briggs was one of twenty plaintiffs who were charging that R.W. Elliott, as president of the Clarendon County School Board, violated their right to equal protection under the fourteenth amendment by upholding the county's segregated education law. Briggs featured social science testimony on behalf of the plaintiffs from some of the nation's leading child psychologists, such as Dr. Kenneth Clark, whose famous doll study concluded that segregation negatively affected the self-esteem and psyche of African-American children. Such testimony was groundbreaking because on only one other occasion in U.S. history had a plaintiff attempted to present such evidence before the Court.

Explanation:

There has been a high rate of bicycle accidents in your community. The local police department has decided to host free bicycle safety seminars at a local community center. The officers who conduct the trainings are being paid for the time they conduct these seminars.

Is this example a public policy?

Answers

Answer:

yes they are helping with the incidences of the bicycles

Explanation:

Yes they are helping by serving the public

what is the example of red lie?​

Answers

red lie are lies to harm others

Explanation:

example:

Danice: Mr William Jake took your phone and smashed it on the ground

Mr William: What?

* Then Mr William argued with Jake and scolded him so therefore Danice told a red lie*

Hope it helps

A claim made with full knowledge that the opposing person already knows it to be untrue.

What is a red lie?

Red lies are just about retaliation and spite. The desire to hurt others, regardless at the cost of one's own harm, drives them. "A brilliant red lie" refers to a complete fabrication or something wholly at variance with the truth. The phrase "a red stranger" is another way we describe an individual who is a complete stranger.

An example of a red lie will is:

Even though you detest the meatloaf, you proclaim to your mother that it is excellent. You do not wish to tell her buddy that she's gained a significant amount of weight and appears heavy, so you respond as she asks saying he doesn't look big in her dress. In this, there is a  red lie that is presented.

Learn more about red lie, here:

https://brainly.com/question/25427223

#SPJ2

An attempt by the seller to limit responsibility to the consumer in case anything goes wrong.

A - Disclaimer
B - Warranty
C - Defect
D - Contract

Answers

Answer:

D) A contract.. that the obvious because when you do business with anyone you would want to have a contract on deck because people play games and also so if things go wrong you have proof in court.

Essay on civil and criminal laws on malaysia?

Answers

Answer:

are various definitions of the term “legal system”. A Legal System is the framework of rules and institutions within a nation regulating individual’s relations with one another and between them and the government.(Book) In this world, there are many types of legal systems, but the few major legal sytems of the world today are civil law, common law, customary law, religious law, socialist and mixed law systems.

Civil law is the dominant legal tradition today in most of Europe, all of Central and South America, parts of Asia and Africa, and even some discrete areas of the common-law world, like Louisiana and Quebec. The origin of civil law is from the Roman law. The civil law is a set out of comprehensive system of rules which are applied and interpreted by judges. Besides that, civil law is older, more widely distributed and in many ways more influential than the common law.

Common law is a system of law that is derived from judges’ decisions, rather than statutes or constitutions. It is based on tradition, past practices and legal precedents set by courts through interpretation of statues, legal legislation, and past rulings.It is english origin and is found in United States and other countries with strong english influences

Customary law is a traditional common rule or practice that has become an intrinsic part of the accepted and expected conduct in a community, profession, or trade and is treated as a legal requirement. Not many countries in the world today will operate under a legal system which could be wholly customary. However, customary law still plays a sometimes significant role, like in the matters of personal conduct, in many countries or political entities with mixed legal systems.

Islamic law is derived from the interpretation of the Koran. Its primary objective is social justice, but also includes property rights, economic decision making, and types of economic freedom. Islamic law is mostly found in Pakistan, Iran, and other Islamic states.

Socialist law is based on fundamental tenets of Marxist-socialist state and center on concept of economic, political, and social policies of the state. It can be found in some independent states of the former Soviet Union, China and other Marxist-socialist states.

A mixed legal system is a mixture of two or more legal system practised by some countries.

2.0 Malaysia’s Legal System

Different country practices different types of legal system. Some country practices one type of legal system while others practices the mixed legal system which means a combination of two or more legal systems. Malaysia for example, practices the mixed legal system which includes the Common Law, Islamic law and Customary Law. Malaysia’s legal system comprises laws which have arise from three significant periods in Malaysian history dating from the Malacca Sultanate, to the spread of Islam to Southeast Asia, and following the absorption into the indigenous culture of British colonial rule which introduced a constitutional government and the common law. Malaysia’s unique legal system is designed to balance the delicate racial and religious needs of its heterogeneous people. The Malaysian legal system law can be classified into two . However, according to the democratic ruling system, the Chief Executive is the Prime Minister. This does not mean that the Yang di-Pertuan Agong is unable to voice any opinion, but rather that he must act on government advice, whatever his personal view might be. The Yang di-Pertuan Agong appoints a Cabinet to advise him on country’s matter. The Cabinet consists of the Prime Minister and a number of Ministers who must all be members of Parliament. Besides that, the Government has set up various agencies to ensure the smooth enforcement of the law. It comprised of three main components, namely ministries, departments and statutory bodies.

laws pertaining to persons professing the religion of Islam.

Share this:

Cite This Work

To export a reference to this article please select a referencing stye below:

OSCOLA

APA

MLA

MLA-7

Harvard

Vancouver

Wikipedia

All ltd, 'L

Trustedsite Law

Which of the following is a belief held by the theory of natural law?

Answers

According to natural law theory, all people have inherent rights, conferred not by act of legislation but by "God, nature, or reason." Natural law theory can also refer to "theories of ethics, theories of politics, theories of civil law, and theories of religious morality." Natural law has roots in Western philosophy.

Natural law - Wikipediahttps://en.wikipedia.org › wiki › Natural_law

A(n) ___ is a type of microscope that can analyze the characteristic glow of different fibers.

Answers

Is it a fluorescence microscope ?

Candidates for the U.S. House of Representatives must be at least 25 years old, and candidates for the U.S. Senate must be at least how old? Select one: O A. 25 O B. 21 Ос. 30 O D.35​

Answers

Answer:

It is C.30 years old

Explanation:

Answer: to be senator you must be over the age of 30 years old. To be represenative a person must be 25 of age or older.
Explanation:This is specified in the U.S. Constitution. Most states in the U.S. also have age requirements for the offices of Governor, State Senator, and State Representative.


Please give me brainlyyy❤️❤️

What is the default join type?

Answers

Ans: SQL inner join


The simplest and most common form of a join is the SQL inner join the default of the SQL join types used in most database management systems. It's the default SQL join you get when you use the join keyword by itself. The result of the SQL inner join includes rows from both the tables where the join conditions are met.

Answer:

If this is for edge....it’s A) inner

Explanation:

B. How many members are in the House of Representatives? Why?

Answers

Answer:

There are 535 members.

Explanation:

Five delegates and one resident commissioner serve as non-voting members of the House, although they can vote in committee.

Answer:

435

Explanation:

commissioner serve as non-voting members of the House

examination of bill of entry is done to vouch​

Answers

Answer:

What? I Don't understand

Explanation:

Answer: Custom !!!!!

Damian and Hunter are college roommates from very different walks of life. Damian was raised in a poverty-stricken city by a single mom. Hunter is the son of a small-town doctor and his socialite wife. Regardless, they get along well. Over time, they become known around campus as a good source for illegal drugs. For several years, Damian and Hunter run their business successfully. When the police finally catch up with them, they are both arrested. Following the theory of radical criminology, what is MOST likely going to happen to the two men?

A.
Damian will get an easier sentence because he did not have the advantages that Hunter did.

B.
Hunter will get a harder sentence because he had more privileges growing up.

C.
Both men will get equal sentences under the law.

D.
Damian will get a harder sentence because of his background.

Answers

Answer: D. Damian will get a harder sentence because of his background

Explanation:

Radical criminology bases its opinion on the fact that the state uses its power to make laws that will be beneficial to the ruling class while the working class are left out. It simply means that the laws made benefits the rich at the expense of the poor in the society.

Therefore, since Damian was raised in a poverty-stricken city by a single mom while Hunter is the son of a small-town doctor and his socialite wife, Damian will get a harder sentence because of his background.

Can you sue and win if someone is black mailing you over something illegal you did. If not is there any thing else you can do to take legal action and protect yourself.

Answers

I’m not sure that you’d win the argument as you could possibly face repercussions of the act you did that was illegal...two wrongs won’t make a right basically.

Plz answer questions 3-10 correctly, will give brainliest​

Answers

If farted in a police station is that destruction of property if my fart melted the chair

How does Levi from aka help better understand the government

Answers

Answer:

By making it better for others

Explanation:

It’s Ryun he’s amazing ok bye

What can people do if they feel that a law is unfair?

Answers

People who think that the law is not fair can approach the court to decide on the issue. The court has the power to modify or cancel laws if it finds that they don't adhere to the Constitution.
hope this help!

Answer: People who think that the law is not fair can approach the court to decide on the issue. The court has the power to modify or cancel laws if it finds that they don't adhere to the Constitution.

How is the citizen important in American heroes

Answers

Answer: they ply there important roles as citizens

Explanation:

The course of action a government takes in response to an issue or problem is called
federalism.
A. Federalism
B. Bureaucracy
C. public policy.
d. interstate policy.

Answers

A. Federalism

:)
I am typing extra words because it won’t let me answer until I have 20 characters.
Federalism is the correct answer

Bistro Caterers contracts with Corporate Towers to cater the firm’s business meetings. Later, the contract between Bistro and Corporate is completely rescinded. Even later, Bistro offers to make a new deal. Corporate is willing to deal, but for a new price. Bistro and Corporate
a. may agree to a new contract, but it cannot include a new price.
b. must perform the part of their original contract that is executory.
c. must perform their original contract.
d. may agree to a new contract that includes the new price.

Answers

Answer:

d. may agree to a new contract that includes the new price.

Explanation:

A contract can be defined as an agreement between two or more parties (group of people) which gives rise to a mutual legal obligation or enforceable by law.

There are different types of contract in business and these includes: fixed-price contract, cost-plus contract, bilateral contract, implies contract, unilateral contract, adhesion contract, unconscionable contract, option contract, express contract, etc.

Mutual assent is a legal term which represents an agreement by both parties to a contract. When two parties to a contract both have an understanding of the parameters, terms and conditions surrounding a contract, it ultimately implies that they are in agreement; this is generally referred to as mutual assent.

Since the original contract has been completely rescinded (declared void, repealed or annulled), Bistro and Corporate may agree to a new contract that includes the new price based on mutual assent between the two parties.

What is a warranty?
(A) It is a stipulation about the contract.
(B) It is a stipulation essential to the main purpose of the contract
(C) It is a stipulation collateral to the main purpose of the contract.
(D) It is a statement of commendation by the seller.

Answers

Answer:

C) because when you give a warranty its collateral if the product is lost, breaks, and ect that why you pay a little extra money

How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

Answers

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

Other Questions
Geometry pls help me need help In the equation y = 5 + 3x what is the y-intercept ? Which of the following is a nickname for New Englanders?A) DixiesB) EnglishmenC) WaterboysD) Yankees solve for x . Leave your answer in the simplest form Which statement best explains why tension grew between European leaders over colonialism in Africa? A. Some believed th... Sujet: Etes vous pour ou contre le concours de beaut ? Find the equation of the line shown.(Please help me) Exploration brought Europe and the Americas in contact with one another. This resulted in the movement of people, plants, animals, and germscalled the Columbian Exchangethat changed life on both continents. Was the Columbian Exchange good for the world? Write an essay for your teacher and peers in which you argue your view. Sean is cutting construction paper into rectangles for a project. He needs to cut one rectangle that is 16 inches 15 1/4 inches. He needs to cut another rectangle that is 10 1/2 inches by 10 1/4 inches. How many total square inches of construction paper does Sean need for his project? use finir and tre en ligne in a sentence Help Please Who Ever Gets It Correct I Will Mark BRAINLEST!!! Please Help !!! Can any of you guys help Which expression is equivalent to 5 (a + b) why do spider bites itch? The diagram on the left shows the layers of Earth's atmosphere and how temperature changes with altitude. The diagram on the right shows the layers of Venus' atmosphere and how temperature changes with altitude. Both diagrams indicate the altitude below which 90% of each atmosphere's mass is located.According to the diagrams, which of the following statements is true? A. 90% of the mass of Venus' atmosphere is within 10 km of the surface. B. The upper part of Venus' troposphere is about 200C colder than the upper part of Earth's. C. Venus' troposphere is several times thicker than Earth's troposphere. I have an unknown volume of gas at a pressure of 0.500 atm and a temperature of 325 K. If I raise the pressure to 1.20 atm, decrease the temperature to 320. K, and measure the final volume to be 48.0 liters, what was the initial volume of the gas? sisters homework i dont want to do it lol 2 questions First slide question 1second slide question 2 On a coordinate plane, a red line, labeled g of x, begins on a negative slope, crosses the x-axis at (negative 2, 0), the y-axis at (0, negative 2), and crosses the x-axis on a positive slope at (2, 0). A straight blue line with a negative slope, labeled f of x, crosses the y-axis at (0, 2) and the x-axis at (2, 0).Which statement is true regarding the functions on the graph? A group of students were interested in showing photosynthesis occurring visually. They decided to use bromothymol blue which is an indicator that turns green when there is a high concentration of carbon dioxide and blue when there is a low concentration of carbon dioxide in water. All the tubes started out blue, but students blew carbon dioxide into two of the test tubes turning them green. They left one test tube of each color as their control and put a piece of aquatic plant in the other two tubes. Then, they put all four of these tubes outside (Monday 7 am). When the students checked their tubes in the afternoon (Monday 1 pm), they were so excited to see that tube D had turned blue! Carbon dioxide was going away and being replaced with oxygen. When the students checked their experiment early the next morning, tube B and D had both turned green! Did photosynthesis occur during the experiment? Support your claim with evidence explain your reasoning. hello i need help fast