Answer:
True, if inhaled in great amounts by other organisms
Explanation:
plants convert carbon dioxide into oxygen.
How is the organism in bread used?
Answer:
yeast
Explanation:
i think............................
I'm not sure
What is the role of DNA in an organism ? how is dna related to reproduction
Answer:
DNA plays a role in the growth and reproduction of organisms.The function of DNA is to store all of the genetic information that an organism needs to develop, function, and reproduce.DNA contains the instructions needed for an organism to develop, survive and reproduce.
Which action would be completed by skeletal muscle tissue 1.moving blood
2.increasing the heartbeat, or 3. kicking a soccer ball
Answer:
Kicking a soccer ball
Explanation:
Answer:
Kicking a soccer ball
Explanation:because moving blood and having a heartbeat arent in need of a skeletal system
. Why is the carpel considered female and the stamen male?
Answer: A carpel is the female reproductive part of the flower, interpreted as modified leaves that bear structures called ovules, inside which the egg cells ultimately form and composed of ovary, style and stigma. Stamen, the male reproductive part of a flower, consisting of a long slender stalk and the pollen-producing anther.
Explanation:
Which answer choice correctly lists the flow of food through the GI tract (gastrointestinal tract) of the digestive system?
mouth-- stomach-- small intestine-- large intestine-- rectum
rectum-- large intestine--- small intestine--- stomach--- esophagus-- mouth
mouth-- esophagus-- stomach-- small intestine--- large intestine--- rectum
mouth-- stomach-- small intestine-- esophagus--- large intestine-- rectum
Answer:
mouth--esophagus--stomach--small intestine---large intestine---rectum
Explanation:
The pattern of natural selection where BOTH of the extreme versions of a trait are more advantageous than the average, so a population evolves in both directions away from the average.
Answer:
Stabilizing Variation.
Explanation:
This is the type of variation that occurs when genetic diversity decreases as the population of organism in a particular population based on a specific trait.
Organisms with varied or specific traits within the population are selected against by the selection pressure, with little chances of reproduction, while organisms in between, ( with least variation of this particular traits) which are within the narrow range, survive to reproduce.Thus, this gives rise to narrow population of these particular organisms,(stabilizing variation) which are therefore naturally selected.
Therefore, the variation of the organisms in this population is kept close to the centre of the same mean value.
The landform pictured above is _____, which has formed out of _____ and _____.
O A. a glacier, snow; ice
B. a glacier; ocean water, snow
O C. a mountain; snow; ice
OD. an iceberg; ocean water, snow
Answer: a glacier; snow; ice
Explanation:
Just did it and it was right
Tracey was learning about structural organization in animals. What level of structural
organization BEST describes an egg?
A. a cell
B. a tissue
C. a system
D. an organ
Answer:
A
Explanation:
Egg cell
The level of structural organization which best describes an egg is: A. a cell.
A cell can be defined as the fundamental (basic) structural, functional, and smallest unit of life, that is typically found in all living organisms such as animals.
The structure of an egg is similar to those of cells found in living organism, which are structurally layered with various cell organelles.
An egg shell is selectively permeable because it acts as an outer membrane just like in living cells to prevent unwanted materials from going into the egg.
In conclusion, the level of structural organization in animals cells can best be describe by using an egg.
Read more: https://brainly.com/question/19559847
I need to list the order of traits from sponges to mammals in which they appear from an evolutionary standpoint. I don't know how to find the correct order
Answer:
please put a picture of the work you have to do so i can help you
Explanation:
Butterflies usually are identified by the colors and patterns on their wings. Butterflies have four wings: The two wings near the butterfly’s head are “forewings” while the wings near the butterfly’s tail are “hindwings.” You can use the following dichotomous key to identify four common butterfly species in North America.
The shown butterfly in the diagram is - Papilio polyxenes.
Butterflies usually are identified by the colors and patterns on their wings. To identify an organism using a dichotomous key, compare the organism’s traits to the first pair of descriptive statements on the key.
Follow the directions after each matching statement until you get to the organism’s identity.The points on the hindwings identify the butterfly as
a swallowtail butterfly is either Papilio glaucus or Papilio polyxenes.1. Hindwings rounded ………………… Goto 3
2. Wings mainly yellow …………… Papilio glaucus
Wings mainly black ………….. Papilio polyxenes
3. Wings orange with black piping…Danaus plexippus
Wings yellow with black edges….. Colias philodice
The wings are mainly black, so the butterfly is Papilio Polyxenes (common black swallowtail)Thus, the shown butterfly in the diagram is - Papilio polyxenes.
Learn more:
https://brainly.com/question/2235448
1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.
Answer:
Explanation:
BY USING FOREST WISELY;
It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;
1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.
2) Those trees of the world make up of portion land species by more than forth or fifth portion.
There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as
hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth
Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.
COMMUNITY CONSERVATION;
It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.
These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.
There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as
Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.
The article 'By using Forest Wisely' can be summarised as:
People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem. The trees produce oxygen and they made up at least a quarter of the world population.The trees occupy the fourth or fifth portion of the land organisms.In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die. The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available. Trees are required for manufacturing important materials.The article 'Community Conservation' can be summarised as:
In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating. The humans occupied the space to practice farming and make houses. The population of the gorillas was disturbed and diminished. The hunting of gorillas by poachers was also reduced. The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife. Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.
To know more about forest conservation, refer to the following link:
https://brainly.com/question/16505239
explain how gas is compressed into liquid in a gas barrel
Explanation:
A gas can be converted into a liquid by increasing the pressure & decreasing temperature. So that the condensation occurs. You must also make the molecules closer so that it is a phase change from a gas to liquid. In liquids, the molecules are very near than that of gases.
burning fossil fuels, it makes the Earth colder.
What percent of the atmosphere is carbon dioxide?
A.4%
B.0.4%
C.40%
D.0.04%
Answer:
B i took the test
Explanation:
Answer: D
Explanation: Only 0.04% of the atmosphere is carbon dioxide.
Earthworms, small insects, and microorganisms live in the soil and break down dead plants and animals. What would happen to an ecosystem if this process was compromised?
A.
The population of green plants in the ecosystem would increase.
B.
There would be more energy available to consumers in the ecosystem.
C.
The soil quality of the ecosystem would dramatically improve.
D.
The carrying capacity of the ecosystem would be limited.
Answer: D
Explanation:
Since the Earthworms, small insects, and microorganisms live in the soil and break down dead plants and animals. They end up playing a vital role in the ecosystem, if this were to be compromised nothing good would come form it Disease, competition, predator-prey interaction, resource use and the number of populations in an ecosystem all affect carrying capacity. If Earthworms, small insects, and microorganisms couldn't break down the the dead material and return it to the soil, then surely the carrying capacity would be drastically effected.
Please help me, thank you!
Gene: is a unit of heredity which is transferred from a parent to offspring and is held to determine some characteristic of the offspring. An example is hair or eye color
Allele: is different forms of a gene. An example would be how tall or short.
Homozygous: is two alleles that are the same trait. An example would be two alleles for straight hair.
Heterozygous: is two different traits like one for staright and one for curly hair.
Dominant: is the stronger form of an allele. Like the grey fur is the stronger one
Recessive: is the weaker form of an allele. Like white hair is the least likely.
Pheneotype: is the physical apperance.
Genotype is the genetic makeup of an organism.
Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG
Answer: DNA
Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.
RNA has all of those except for adenine which is replaced with Uracil.
A virus is ________ a cell.
A)bigger than
b) the same size as
C)smaller than
d)another word for
Answer:
smaller than
Explanation:
But they're nothing compared to the giants of the cellular world. ... And viruses are smaller again — they're about a hundredth the size of our cells. So we're about 100,000 times bigger than our cells, a million times bigger than bacteria, and 10 million times bigger than your average virus
Hope this helps <3
A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?
A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left
Answer:
Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30
F=ma.
30=30a
a=30/30
a=1m/s^2
Drag each description to the correct type of succession.
vacant parking lot for many years
Primary succession
Secondary succession
abandoned baseball field
recently cooled lava field
rocky hill under a melted glacier
clear-cut forest
1) Intro
Done
ivity
Answer:
1) vacant parking lot for many years (secondary succession)
2) abandoned baseball field (secondary succession)
3) recently cooled lava field (primary succession)
4) rocky hill under a melted glacier (primary succession)
5) clear-cut forest (secondary succession)
Explanation:
Succession in ecology is the gradual encroachment of life on a given ecosystem.
Primary succession involve a new never-before colonized region like a new lava deposit or land hidden under glacial sheets. Secondary succession is the encroachment of life on an area formerly harboring life but had experience a disturbance like wildfire, agricultural activities, logging etc.
Answer:
PRIMARY SUCCESSION (recently cooled lava field) and (rocky hill under a melted glacier). SECONDARY SUCCESSION (vacant parking lot for many years) (abandoned baseball field) and (clear-cut forest.
Explanation:
it's correct
State the three parts of the cell theory.
Answer:
The three parts of the cell theory are: cells are the smallest unit of life; all cells come from preexisting cells; and living thing is made up of one or more cell.
All living organisms are composed of what?
All living organisms are composed of one or more cells.So, your answer would be Cell.
hope it helps!
b. Why is it possible to move the object that way?
Answer: Because force gives an object energy to move in a certain direction. The distance that object travels all depends on the amount of force used and the amount of friction the object intakes.
Place the appropriate terms into the table
Answer:
Kindly, provide us with a table, thank you! :)
Explanation:
Can somebody help with those 3 problems please
Answer:
first one is option A
second one option B
third is26 N
Explanation:
1.the law here is every action has an equal and opposite......
2. only unbalanced forces move objects from rest or of uniform motion
3.net force is the sum of forces ,if forces are in the same direction
hope this helps plz mark me brainliest
Please help out! It would be very nice !!
Answer:D
Explanation:
Cell wall provides structure and protection
Answer:
D is the answer to the question
DNA is a molecule that stores____information in the cells
Answer: instructions
Explanation: trust me
Answer:
genetic
Explanation:
Which of the following delivers oxygen to the body?
Mark all that apply
Arteries
Veins
Capillaries
Hemoglobin
A multicellular organism typically begins as a single cell, and then many cell divisions occur to generate the cells of the adult organism. However, these cells are not identical to the original cell, and they are not identical to one another.
What is the most significant cause of cell differentiation in a multicellular organism?
A.
differences in the number of chromosomes per cell
B.
differences in the genetic code used by different cells
C.
differences in the DNA that is copied and distributed among the cells
D.
differences in gene regulation and gene expression among the cells
Answer:
D
Explanation:
Difference in cell regulation and cell expression. This is embedded in chromosomes which is the blue print of the organism. The chromosomes is like the house plan when you building a house.
The most significant cause of cell differentiation in a multicellular organism is: D. differences in gene regulation and gene expression among the cells.
What is cell differentiation?Cell differentiation can be defined as a process through which a young, unspecialized cell undergoes various changes in gene expression, so as to become a specialized that is more specific in terms of function.
In a multicellular organism, which is an organism with multiple cells, the most significant cause of cell differentiation is as a result of differences in gene regulation and gene expression among its cells.
Read more on cell differentiation here: https://brainly.com/question/13846411
WILL MARK BRAINIEST!!!! PLZ!!!
Which system of equations is equivalent to the following system?
4x + y = 4
2x + 7y = 28
4x + y = 4
−2x − 7y = 28
4x + y = 4
−8x − 28y = 112
−28x − 7y = −28
2x + 7y = 28
−8x − 2y = 8
2x + 7y = 28
Answer:
D.
Explanation:
Answer:
D
Explanation:
What percentage of Japan’s population is between the ages of 0–4 years?
Answer:
looks like about 8% to me
40 to 44 percent of people are in the range of 0 to 4 years.
What is the population?A population is a group of different people. There are three different types of population such as rapid growth, slow growth, and negative growth.
In rapid growth, the population will grow rapidly. While slow growth population grows very slowly. In negative growth population growth is negative.
In the population graph, male and female growth is shown. The darker color in the population shows males and the lighter color shows females population.
Therefore, 40 to 44 percent of people are in the range of 0 to 4 years.
To learn more about the population, refer to the link:
https://brainly.com/question/27991860
#SPJ2