En la raza de ovejas Rommey Marsh, un gen conocido como gris letal, provoca que el feto gris GG, muera antes de las 15 semanas de gestación; El Genotipo heterocigótico Gg produce lana gris y el genotipo homocigótico gg produce lana negra. Si se cruzan individuos heterocigóticos. Cuáles serán las proporciones fenotípicas esperadas en la progenie viva? *

Answers

Answer 1

Answer

1:2:1

Please  check the file,due to technical reasons there was issues  with submission

Explanation:


Related Questions

Shivering and vasoconstriction would be signaled to cause a: A. increase in pH. B. decrease in temperature. C. decrease in pH. D. increase in temperature.

Answers

Answer:D

Explanation: shivering occurs when someone is cold and vasoconstriction is when the blood vessels close to the skin and the veins closer to the skin surface constrict as a result of dat air doesn’t enter the body

Vasoconstriction is the narrowing of the blood vessels that hinders blood flow. Vasoconstriction and shivering will lead to an increase in the temperature through thermoregulation. Thus, option d is correct.

What is thermoregulation?

Thermoregulation is the maintenance and balancing of the temperature and heat in the body. They are regulated by many factors including shivering and vasoconstriction.

During the vasoconstriction, the blood vessels close to the skin surface close and the body shivers as a result of cold or decreased temperature. This signals the body to increase the temperature so that shivering can be stopped.

Therefore, vasoconstriction and shivering signal the body to increase the temperature.

Learn more about thermoregulation here:

https://brainly.com/question/7450241

#SPJ2

what does Ecology mean

Answers

The branch of biology that deals with the relations of organisms to one another and to their physical surrounding

Answer:

a branch of science concerned with the relationships between living things and their environment or the pattern of relationships between living things and their environment.

Explanation:

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

what action is a reflex action

Answers

Answer:

A reflex action is an involuntary , quick  response to a stimulus, which minimises any damage to the body from potentially harmful conditions, such as touching something hot.

Explanation:

what are sex hormones?why are they named so? state their function.

Answers

Answer:

Sex hormones or hormones of the reproductive organs are certain cells in the reproductive organs that produce hormones.

The testis produces testosterone,the male sex hormone,and the ovaries produces oestrogen and progesterone, the female sex hormones.

In a sexually mature male,testosterone influences sexual behaviour, and together with FSH,regulates sperm production in the seminiferous tubules of the testes.

Sexually matured females undergo a regular 4-week reproductive or menstrual cycle during which a mature egg is released.This cycle is regulated by oestrogen and progesterone. During pregnancy, progesterone inhibits egg production (ovulation),brings about the development of the placenta and prevents the uterus from contracting....I hope this answers your question... Thank you for the question.

can DNA be extracted from dead cells

Answers

The short answer is yes. Based on your DNA, your body is better suited for some foods than others. This company found that 45% of people’s genes need a high carb diet, 47% need moderate and only 8% need low.

Hope this helped! <3

Write TRUE or FALSE
(a)
A 'system' is the part of an organism that carries out a certain function.​

Answers

Answer:

TRUE

Explanation:

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

what mode of nutrition is house fly​

Answers

Answer:

Houseflies do not have chewing mouthparts like a cockroach or piercing-sucking mouthparts like a mosquito. They regurgitate digestive enzymes, soften and liquify the food material, and then they sop it up with their sponging mouthparts.

Hope this makes sense and helps

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

The dark organelles labelled E is called the Ribosomes.    

The answer is Ribosomes

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

The proximal convoluted tubule is A. lined with epithelial cells that lack microvilli. B. the site of glucose and amino acid reabsorption. C. permeable to water if ADH is present. D. impermeable to water. E. the site of water secretion.

Answers

Answer:

The correct answer is - option B.

Explanation:

The proximal convoluted tubule or PCT is the the part of nephron that lies in between of loop of Henle and bowman's capsule. The PCT is responsible for the most amount reabsorption of sodium, glucose, amino acids, water, potassium and chloride and reabsorbs around 65% to 100% of filtered substance.

Epithelial cells in the PCT reabsorb substances that have nutritional importance by the numerous microvilli on their surface.

Thus, the correct answer is - option B.

How much time is required for a P-wave to travel 6,000 kilometers?

Answers

Answer:

294.1 minutes

Explanation:

5,882 seconds (98 minutes) to travel 2,000 km.

2,000 x 3 = 6,000

5,882 seconds x 3 = 17,646

(294.1 minutes) to travel 6,000 km

I have four brothers
"This is what type of
observation?

Answers

Quantatative data since it is physically counting

Witch statement correctly compares the “analysis” and “conclusion” section of a lab report

Answers

Answer:

Analysis section of lab report comprises of making comparisons while Conclusion section is used to make further research about the experiment.

Explanation:

Analysis section of lab report comprises of making comparisons between specific data. After knowing the scope and objectives of the experiment, data is collected either by performing the experiment or adopted data from other organization such as hydrological data obtained from hydrological agency, analysis of such data comprises of making comparisons.

While

Conclusion section is used to make further research about the experiment. It is used to report the outcome of the result and also to determine other possibilities of results from the experiment.

Metals are useful in industry because they can be shaped without breaking. What is this property of metals called?

Answers

Answer:

malleable ................

Answer:

versatility ductility conductivity malleability

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.

Which is most likely a source of air pollution? littering CFCs oil spill runoff

Answers

Answer: CFCs

Explanation: The other options aren’t as relevant to air pollution.

Answer:

cfcs

Explanation:

What is another name of molecular biology????

Answers

Answer:

biotechnology

Explanation:

hope it help you

Answer:

biotechnology biotech

biological engineering biological science

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

How are the molecules in photosynthesis and cellular respiration similar? Please include descriptions of the molecules

Answers

Answer:

They are similar because they both produce energy but in two different forms.

Photosynthesis- It produces oxygen and G3P, simple carbohydrate molecules that are high in energy and can be converted into glucose, sucrose, or other sugar molecules.

cellular respiration-During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.

They exhibit the same responses, but they do so in reverse. Carbon dioxide and water are converted during photosynthesis into glucose and oxygen. Carbon dioxide and water are produced during respiration in exchange for glucose and oxygen.

What similarity in photosynthesis and cellular respiration?

Energy transformations from one form to another are a part of both respiration and photosynthesis through a sequence of metabolic reactions.

The reactions that are carried out by both processes—which both use and produce ATP—are carried out on membranes and are managed by enzymes.

Light energy is converted by photosynthesis into chemical energy that is stored in glucose, which is then released by cellular respiration to create ATP, the life-sustaining compound.

Therefore, They are similar because they both produce energy, but in two different forms.

Learn more about cellular respiration here:

https://brainly.com/question/28532054

#SPJ2

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

what are some non examples of hydroshere

Answers

Oceans, lakes, seas, and clouds are examples.

The hydrosphere is made up of all the water on the planet, including the water found below the surface and in the atmosphere. A planet's hydrosphere may be liquid, vaporous, or composed of ice. The three surface water bodies on Earth are oceans, lakes, and rivers.

What are some non examples of hydrosphere?

It comprises all surface waters that are liquid or frozen, groundwater that is contained in soil or rock, and atmospheric water vapor. The hydrologic cycle continuously circulates almost all of these waters. In wells and aquifers, it can also be found underground as groundwater.

Within the hydrosphere, water circulates in a cycle. Clouds contain water that eventually falls to Earth as rain or snow.

Therefore, Rivers, lakes, and seas are where this water gathers. The cycle is then restarted by its evaporation into the atmosphere. The water cycle refers to this.

Learn more about hydrosphere here:

https://brainly.com/question/14686427

#SPJ2

PLEASE ANSWER ASAP!!!!!!!! ITS DUE IN 5 MINUTES.

1.) How do organisms benefit from Mitosis? Write a paragraph using at least five sentences.


Answers

Answer:

Organisms benefit from mitosis because mitosis helps regenerate cells. This helps them recover from injuries and more.

Explanation:

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

here are times where you will be provided with BUD dates. When you do not have access to the BUD dates, you will have to determine that date yourself. What is the appropriate BUD date for a water containing oral formulation? Not later than 14 days Not later than 30 days

Answers

Answer:

Explanation: Not later than 14 days.

Beyond Use Date (BUD) is the date after which a compounded sterile preparation may not be stored or transported. This time is calculated from the date of compounding, and it is different from expiration date. This is because the BUDs are assigned with a different approach from those applied to assigning expiration dates to  manufactured drug products. Also, compounded preparations are intended for administration following short-term storage. So, the BUD is the date after which a compounded preparation shall not be  used. A reliable BUD is established to ensure that the preparation  has an accepted quality and purity at least  until the labeled BUD.

BUD is calculated by:

Type of container in which it is packagedHow long the medication will be takenType of drugHow fast is the drug degradatedStorage conditionsDosage of the medicationNature of the drug and its degradation mechanism Potential for microbial proliferation in the preparation

For Nonaqueous Formulation, the BUD is not later than 6 months or the time  remaining until the earliest expiration date of any API (Active pharmaceutical ingredient), whichever is earlier.  

For Water-Containing Oral Formulation, the BUD is not later than 14  days when it is stored at controlled cold temperatures.

For Dermal and Mucosal Liquid, Semisolid Formulations/Water-Containing Topical, the BUD is not later than 30 days.

Metamorphosis is:______.a. changing of one body form to another within a species, such as the change from an aquatic tadpole to a terrestrial frog. b. an intermediate condition, such as length of legs in mice between longer legs of some mice and shorter legs in others, a condition caused by Hox genes. c. the evolutionary transition from fishes to amphibians. d. the developmental changing of a scale to a feather.

Answers

Answer:

changing i think

Explanation:

Other Questions
New York City is a popular feild trip destination. This year the seniorclass at High School A and the senior class at High School B bothplanned trips there. The senior class at High School A rented and filled8 vans and 4 buses with 220 students. High School B rented and filled 12 vans and 4 buses with 228 students. Every van had the samenumber of students in it as did the buses. How many students can avan carry? How many students can a bus carry? 70% of what number is 56 TRUE OR FALSE French debt under Louis XVI was high because the French government helped fund the American Revolution. A company with a WACC of 8.5% is considering two possible investments. Project A will return 10% and be financed using equity costing 9.5%. Project B will return 8% and be financed using debt costing 6%. Which project should the company undertake Abhinandan prashansa patra hindi cherry pies ratio is 240 to 3 pies.how many Cherry's to make 9 pies Is the talc renewable? what are the morals and ethics of computer cual es el area de un rectangulo 2.PART B: Which detail from the story best supports the answer to PART A?A. "They talk by flapping their meat at each other. They can even sing by squirtingair through their meat." (Paragraph 31)B. **Officially, we are required to contact, welcome and log in any and all sentientraces or multibeings in this quadrant of the Universe" (Paragraph 35)C. "It seems harsh, but there is a limit. Do we really want to make contact withmeat?'" (Paragraph 37)D."We went into their heads and smoothed out their meat so that we're just adream to them."" (Paragraph 43) Sarah has many dreams and just as many goals. But she is challenged to translate her academic goals into behaviors that will support her success. If you were giving Sarah advice, what would you recommend Hotel Cortez is an all-equity firm that has 10,900 shares of stock outstanding at a market price of $37 per share. The firm's management has decided to issue $66,000 worth of debt and use the funds to repurchase shares of the outstanding stock. The interest rate on the debt will be 8 percent. What is the break-even EBIT What is the decimal equivalent of 16/3 ?A. 5.3B. 0.1875C. 53333...D. 16.3 1+3^225 order of operations There are 45 eighth graders and 20 seventh graders in a school club. The president of this club wants 40% of the clubs members to be seventh graders. How many more seventh-graders must join the club in order to meet the presidents wishes? (Assume that the number of eighth-graders remains the same.) Midhun uses internet to deposit 1 poinand withdraw money from hisbank. Name this type ofbanking.e-commerceO e-bankingO e-paymentO e-lending A set of circular cups are placed so that they are touching rim to rim, as close together as possible. It is not possible to fit more cups inside the group if the longest straight line is five cups long, how many cups are there altogether? Which is the simplified form of the expression ((2 Superscript negative 2 Baseline) (3 Superscript 4 Baseline)) Superscript negative 3 Baseline times ((2 Superscript negative 3 Baseline) (3 squared)) squared? how do you run a function in python? why do you think india and pakistan were so concerned about winning the accession of the various princely states?