El planteamiento (premise) de Perú Rock Ópera es que si los grandes compositores vivieran en este siglo,

Answers

Answer 1
Could you please translate it in English

Related Questions

Answer these questions about the main ideas and supporting details in this nonfiction text, “The Sixth of January.”

1. What is the main idea of this reading

2. What details support the main idea

3. What do children do before January 6

4. What do the children do in day six?

5. In the US, many children believe in Santa Claus. His ads the traditions of Santa Claus and the Three Kings similar? How are they different?

Answers

1. The text talks about the Sixth of January, one of the favorite days of the year for Hispanic children.

2. In this day, Melchor, Gaspar and Baltazar come riding on their camels to bring gifts to children.

3. The day before, families go to the city center to see a parade and Los Reyes Magos. Then children gather food for Los Reyes Magos and their camels.

4. The morning of the Sixth children wake up early to see what Los Reyes Magos brought them.

5. They are similar because like Santa, Los Reyes Magos bring gifts to children and children write them letters and leave them food. They are different because it is celebrated in another day, there are three people bringing gifts instead of one, they ride camels and not reindeers, Santa didn’t appear in the Bible while Los Reyes Magos, were three kings from eastern territories that brought gold, frankincense and myrrh to the baby Jesus.

4. Rosa y tú _____________(ir) a la casa de playa todos los veranos.

Answers

Answer:

Van

Explanation:

Rosa y tú van a la casa de playa todos los veranos.

Answer:

Rosa y tú (van) a la casa de playa todos los veranos.

Explanation:

No compraré las entradas ___________________, porque es posible que no encuentre asiento. A. de la canción B. de los instrumentos C. en la audiencia D. en el lugar del evento

Answers

Answer:

D. en el lugar del evento.        

Explanation:

No compraré las entradas ___________en el lugar del evento________, porque es posible que no encuentre asiento.                          

Spanish need help please will give thanks or brainliest to the correct answer

Answers

Answer:

1. me interesa

2. nos importa

3. te encantan

4. les interesan

5. le queda

6. me quedan

Explanation:

Me interesa

Nos importa

Te encantan

Les interesan

Le queda

Me quedan

Hope this helps; have a great day!

Write on the motion :Co education is the best​

Answers

sorry i don’t know :(
i don’t think this is spanish....LOL

Cuentan que cuando la tierra estaba en la oscuridad, era siempre de noche. Los poderosos que vivían en el cielo se reunieron para crear el sol y para que hubiera luz en la tierra. Se reunieron en una ciudad llamada Teotihuacán que había en el cielo, y de la cual ciudad de Teotihuacán que está en México eran como una sombra o un reflejo. Aquel poderoso que quisiera convertirse en el Sol debía arrojarse en esta hoguera y quemarse en ella para resurgir como el Sol. Dos candidatos eran para ser el Sol; el Primero era grande, fuerte, hermoso y rico que, además, estaba vestido con ropas de lujo y adornado con piedras preciosas.

Lee el original aquí: http://www.leyendascortasparaninos.com/2014/07/la-leyenda-del-sol-y-la-luna.html

¿Cuál de las siguientes frases describe el fragmento?

Es una parábola porque la intención es una enseñanza cultural del origen del terremoto.
Es un cuento de hadas porque el argumento toma lugar en un tiempo y sitio de fantasía.
Es un mito porque algunos personajes son dioses o personajes sobrenaturales.
Es una leyenda porque es basada en un suceso real y tiene una historia de la tradición oral.

Answers

Answer:

Es una leyenda porque es basada en un suceso real y tiene una historia de la tradición oral.

Explanation:

Es una leyenda porque es basada en un suceso real y tiene una historia de la tradición oral.

El suceso real es que el sol existe. y la leyenda nos narra como es que se creó el sol.

Answer:

Es un mito porque algunos personajes son dioses o personajes sobrenaturales.

Explanation:

I took the quiz and got it right with this answer

Atilio Pelossi is best remembered for being A. asustado B. muerto C. valiente D. vivo

Answers

Valiente would be the correct answer I believe

Es el punto donde termina el área de un país y empieza otro.
a. el pasaporte
b. la frontera
c. la aduana

Answers

B.la frontera I’m guessing
B. La frontera
Hopefully i’m not wrong.

1. En las tres situaciones siguientes, el mercado está inicialmente equilibrio, Después de cada uno de los acontecimientos descritos, ¿habrá un exceso de oferta o un exceso demanda al precio de equilibrio inicial? ¿Qué pasará, como consecuencia, con el precio de equilibrio.

Answers

Abra un exceso de ofertas y con mejor equilibrio está respuesta es correcta

El 1 of 1
separa a Europa de África y es importante por su ubicación (location).
Question 2 with 1 blankEl Museo Nacional Centro de Arte Reina Sofía está en 1 of 1
.
Question 3 with 1 blankEl famoso arquitecto modernista Antoni Gaudí nació en 1 of 1
.
Question 4 with 1 blankEl 19 de marzo se queman en las calles Las Fallas de 1 of 1
.
Question 5 with 1 blank1 of 1
es un centro pesquero y su puerto es uno de los más activos de España.
Question 6 with 1 blankLa ciudad de 1 of 1
es un centro importante de academias de baile de música flamenca.

Answers

Answer:

El museo Nacional Centro de Arte Reina Sofia esta en Europa

El famoso arquitecto modernista Antoni Gaudi nacio en Europa

El 19 de marzo se queman en las calles Las Fallas de Europa

La ciudad de Europa es un centro importante de academias de baile de musica flamenca.

Explanation:

(I really didn't understand a lot of what you said, but I hope this help)

PLZZ HELP ME WHO KNOWS THERE AR VERBS PLLZZ ASAPPPP
Number 6

Answers

viajar i think mskdkdkskdb
no
conozco
mis
verbos
pero
esta
bien

Los niños, niñas y mujeres del pueblo se visten con la ropa más bonita que tienen. Es común que las personas que van a este evento especial se vistan con ropa blanca.

Based on the text, why do people who attend the Panchimalco Flower Festival in el Salvador wear white clothes?

- It's a common practice
- It's a requirement to attend
- It's a tradition for the tourists
- It's a way to show unity

Answers

It’s a tradition for the tourists

Sí una máquina de coser tiene un costo de $25,000.00 y valor de salvamento de $8,000.00, además su vida útil es de 10 años ¿cuál es la depreciación anual de la máquina? Al aplicar el método de depreciación lineal o progresión aritmética.

Answers

Answer:

If a sewing machine costs $25,000.00 and salvage value of $8,000.00, plus its lifespan is 10 years what is the annual depreciation of the machine? When applying the method of linear depreciation or arithmetic progression.

Explanation:


Need help please and thank you

Answers

Answer:

Estoy escribiendo

Explanation:

Answer:

Explanation:

Lo siento mucho necesito puntos ten un muy lindo día

Mientras el mundo en estos momentos está preocupado en buscar a los responsables para todos los problemas sociales que existen a todo nivel: la drogadicción, las madres solteras, los refugiados, los inmigrantes, el racismo, etc., la gente se pregunta qué hacer.

Enfrentados a este tipo de problemas que aparentemente no tienen solución, los padres todavía tienen algunas herramientas(tools) a la mano. Hablemos entonces de enseñar valores y principios en el hogar, algo que ha pasado de moda, pero quizás podría ayudar como solución parcial a estos problemas.

Todos soñamos con países subdesarrollados que puedan tener más oportunidades de progreso. ¿Por qué no empezar entonces en las casas con algo tan clásico como enseñar modales en la mesa?: no hables con la boca llena, lávate las manos antes de comer, no le hables así a los mayores, respeta a tu hermano, no salgas a la calle cuando es de noche, ayuda a tu vecino, dale el asiento a los mayores cuando vayas en autobús, etc.

No vaya usted a creer que estos remedios serán la única solución. Sin embargo, pueden empezar a crear conciencia en los niños para que respeten a los demás, al medio ambiente y especialmente a sí mismos, que es precisamente la causa común de casi todos estos problemas. Si empezamos en el hogar, esto ayudará a tener más voluntarios en organizaciones tan importantes como la Cruz Roja, los Cuerpos de Paz, y otras instituciones que benefician a todos. ¡Reflexionemos acerca de esto!



Preguntas de comprensión: (Please number your answers in the space provided below. Your answers must be full sentences in Spanish)

¿De qué está preocupado el mundo?
¿Qué tienen los padres de acuerdo a la historia en las primeras frases?
¿Qué tenemos que enseñar en el hogar?
¿Qué pueden crear estos remedios?
¿En qué organizaciones ayudarán los voluntarios?

Answers

Answer:

1. El mundo se está preocupando en buscar a los responsables para todos los problemas sociales que existen a todo nivel.

2. Los padres tienen la capacidad de enseñar o en otras palabras todavía tienen algunas herramientas a la mano.

3. Lo que tenemos que enseñar en el hogar son los valores y los principios

4. Lo que pueden crear estos remedios es que pueden empezar a crear conciencia en los niños para que respeten a los demás, al medio ambiente y especialmente a sí mismos.

5. Las organizaciones que pueden ayudar los voluntarios serían la Cruz Roja, los Cuerpos de Paz, y otras instituciones de beneficio  

Explanation:

I hope this helps!

The correct answers in Spanish, taking into account the text in Spanish are:

El mundo está preocupado por encontrar responsables para todos los problemas sociales.Los padres tienen herramientas para crear conciencia en los niños.Debemos enseñar principios y valores en los hogares.Estos remedios pueden crear conciencia en los niños.Las organizaciones en las cuales ayudarán los voluntarios son: La Cruz Roja y los Cuerpos de Paz.

Summary of the Text

The text mentions that although we are all looking for blame regarding the different problems that are faced today, parents could start to improve the situation by teaching their children values and principles.

It is hoped that through this teaching, children will learn to value and respect themselves, in such a way that in the future they will be more aware that the needs of society are above those of each individual.

If you want to learn more about Spanish, you can visit the following link: https://brainly.com/question/13403330

Rosario wants to explore a city without a subway. She does not like to drive and prefers not to walk today. What can she do? Rosario puede ________. rentar un auto rentar un mototaxi tomar el metro tomar un avión

Answers

Answer:  rentar un mototaxi

Explanation:

She is going to rent a motorcycle taxi as said in option B.

She wants to explore a city w/o a subway so she can't take the subway as said in option C.

She doesn't like to drive so she wouldn't rent a car as said in option A.

Answer:

B

Explanation:

,
(2) નીચે આપેલ વાતો વાપી તેમાંથી રૂઢિપ્રયોગ અને કહેવતો શોધીને લખો
શિયાળાની કડકડતી ઠંડીમાં ચીંચીં ચકલીએ ચક ચકલા સાથે ખોરા
શોધવા જવાનું નક્કી કર્યું. તેને થયું, એક કરતાં બે ભલા, થોડો વધારે ખોરાક મળ
જશે. પરંતુ બચ્ચાંને માળામાં એકલાં મૂકીને જતાં બહુ જીવ બળતો. કાળ કાગ
હમણાં હમણાં બહુ ચક્કર મારે છે. પણ શું થાય? બધાના પેટનો ખાડો તો પૂરવો
તેણે શકુ સુગરીને પોતાનાં બચ્ચાંને ભળાવવાનું વિચાર્યું. શકુએ પણ કહ્યું કે,
કાળુ તો આદુ ખાઈને પાછળ પડી ગયો છે, તમે ચિંતા ન કરો. ચેતતા નર સદા સુ
હું બચ્ચાંનું બરાબર ધ્યાન રાખીશ.
2.​

Answers

Answer:

Explanation:

સ્પેનિશ અનુવાદ અને રિઝોલ્યુશન:

Anota las siguientes cosas encontrando los modismos y refranes de ella

En el frío amargo del invierno, el gorrión excavado con un gorrión de mandril

Decidí ir a buscar. Pensó, dos son mejor que uno, conseguiremos un poco más de comida

Se irá. Pero dejará a los cachorros solos en el nido quemaría muchas vidas. cuervo negro

Han sido muchas rondas en este momento. ¿Pero qué pasa? Debe llenar el estómago de todos

Pensó en mezclar sus cachorros con una caña de azúcar. Shaku también dijo,

Kalu se ha quedado atrás después de comer jengibre, no te preocupes. Chetta Nar Sada ha cuidado a las chicas correctamente

ઘણા રૂઢિપ્રયોગ અને ઘણી કહેવતો છે ..એટલે કેમનું જવાબ


Ser to be : have to use these words Spanish 1

Somos
Eres
Soy
Es
Son

PLEASE HELP!!

Answers

Answer:

oh I know this

Explanation:

it's like a thing in the text books use ur Spanish textbook

For 8. Is son ,for 9. Is es , 10. Son , 11. Es , 12. Son , 13. Soy , 14. Eres , 15. Son

I will mark brainliest

Answers

Answer:

Research, research, research

Explanation:

It is asking you basically to research all those stuff for your article, but unfortunately, I cannot write your article.

Please help I am desperate
Complete the following sentences with the past imperfect to express influence:

1.Los maestros querían que los estudiantes…

2.Mi padre necesitaba que yo…

3.Esperábamos que el restaurante…

Answers

Answer:

1.Los maestros quieren que los estudiantes aprendan.

2.Mi padre necesitaba que yo ayuda.

3.Esperábamos que el restaurante  fuera bueno.

Explanation:

Sorry, people reported my last question, but here are the answers for the last one:

1.Si los maestros no supiera nada, entonces no pueden enseñar.

2.Si Juan comiera más fruta, no quedaría suficiente comida.

3.Si estudiáramos todos los día tendríamos buenas notas.

Brainlist Pls!

Answer:

Explanation:

1.Los maestros querían que los estudiantes estudiaran y, por tanto, aprendieran para aprobar su clase

2.Mi padre necesitaba que yo estuviera en la reunión de la comunidad

3.Esperábamos que el restaurante tuviera comida internacional

Plzzz help need ASAP all blanks filled in order???

Answers

Answer:

1. habló

2. necesitas

3. viajaron

4.comimos

5. aprendes

6. beben

7. saldremos

8. abrí

9. compramos

10. práctica

Spanish conjugation question? I need help with what the answer is. I do not know much about this stuff (nevermind)

Answers

Answer:

what is the question?

Explanation:

Emmm...the question...? I think it’s a good time to ask it...?

Fill in the blank in the following sentence with the appropriate form of the
verb mirar below.
Juan, me gustan las películas de terror. Vamos al cine esta noche y
una de las nuevas que han salido recientemente.
A. miremos
B. miran
C. miren
D. mirar

Answers

A. Miremos

Miremos means lets watch
Miremos porque son los dos

Translate each sentence to Spanish and replace the direct object and indirect object in each sentence with a direct or indirect object pronoun.
Sandra answers the phone for you.
The teacher tells (contar) the lesson to us.
She follows the compass.

Answers

Answer:

Explanation:

Sandra responde el teléfono por ti.

Sandra lo responde por ti

El maestro nos cuenta la lección.

El maestro nos la cuenta

Sigue la brújula.

Síguela

II. Now write five original sentences using direct and indirect object pronouns and the 5 verbs listed above (dar, escribir, comprar, decir, traer). Make sure that each sentence uses a different combination of subject, direct, and indirect object pronouns. Read each sentence aloud in your recording when you have finished.​

Answers

Answer:

(1) A mi me gusta escribir en mi tiempo libre

(2) A ustedes les gusta comprar ropa todos los días

(3) Le puedes dar el papel a la maestra, porfavor.

(4) Nos puedes decir la respuesta

(5) Le puedes decir a él que si me puede traer esas cajas de la esquina, porfavor

Explanation:

I hope this helps!

Que tipo de texto descriptivo es Los ojos verdes, rasgados; las pestañas luengas; las cejas delgadas y alzadas; la nariz mediana; la boca pequeña; los dientes menudos y blancos; los labios, colorados y grosezuelos; el torno del rostro poco más luengo que redondo; el pecho alto.

Answers

Answer:

Es un texto descriptivo tipo retrato.

how do you say your favorite color in spanish

Answers

Answer:

red

Explanation:

Rojo is how you say the color red.

Answer:

Tu color favorito- Your favorite color

¿Cual es tu color favorito?- What is your favorite color?

(We use 2 interrogation marks)

Explanation:

PLZ HELP DUE SOONNNNNNN

Answers

i believe it’s 1.pudiste and 2.ira

can i fail if i only do my test

Answers

Answer:

maybe

Explanation:

depends how much it weighs in your grade

(30pts) Change the form of the verb according to the noun. Remember to drop the er or it and add the appropriate ending.

Answers

Beben
Come
Vivo
Escribimos
Comprendes
Comparten
Descubren
Vende
Corren
Aprendo
Sales
Barremos
Other Questions
- Identify which 2 positions the Earth is in during an equinox. For what reason are the ideas of democracy and the practice of democracy in separately linked? Mr. Rogers wanted to study the affect of different types of music would have on students ability to complete the IA. What is his dependent variable? What Is his independent variable ?A. classroomsB. types of musicC. IA scoresD. students Monopolies are inefficient compared to perfectly competitive firms because monopolies produce output with average total cost exceeding average revenue produce output with average total cost exceeding average revenue A produce more output than is social desirable produce more output than is social desirable B charge a price less than marginal revenue charge a price less than marginal revenue C charge a price greater than marginal cost charge a price greater than marginal cost D charge a price less than average total cost A baseball is hit in the air. Its height above the ground is described by the function Ht=-16t^2+45t+5, where H(t) represents the height in feet of the ball t seconds after it is hit. To the nearest hundredth of a second, for how much time will the ball be in the air? Find algebraically. help guys plz i suck at math, also step by step is needed Branliest is the reward like always Help, please help!!!!!!!!!!!!!!!!! the difference of two numbers is 7. Three times the greater number is 72. find the numbers What is an example of biotechnology? who is VluspPlease help ASAP!!!!! What is the strongest piece of evidence in the second paragraph of thearticle by Douglass?A)greatness in the ability to organizeB) greatness in the ability to discover truthTheodore Parker's three grades of human greatnessD) greatness in executive and administrative ability PLEASE HELP ME IM GIVING EVERTYTHING FOR THISAll About Me Graffiti Wall PowerPointWorth 25 PointsDue Thursday, April 1, 2021 i dunno TvTSAYS I NEED MORE WORDS OK HERE I AM what does martin luther king jr urge americans to do after police attack protestors on the bridge Please complete the following DNA strands1. AGGTCCAAGCTCAAATTTCCCC2. GAAACCCCTTAAACCTTAATTCC3. GCGCGCGCAAATTTTTCCCATCTPlease complete the following strands using RNA:1. AGGTCCCAAAGGCCCTTTCC2. UAAAGGGCCCAGCCCACC3. CUAAAAGGGGGUUUUAACC Can someone plzzzz help meeee!!!!! Wayne charges the following for repairing washing machines:28 call-out charge + 16 for each half-hour he spends on the repairIf a repair costs 76, how long did it take? 103+1793=????????what is the answer?? Answer both parts please Helpppp me pleaseee Create a complete sentence from each of the following phrase fragments. Add capitalization and punctuation wherever necessary.EllenExample1. has been a gymnast.managing the store