Due to recent political and economic events, general prices of goods and services are expected to increase significantly over the next five years. You were about to purchase a five-year bond. You now require a higher return on the bond than you did before you found out about these expected price increases. Determine which of these fundamental factors is affecting the cost of money in the scenario described:

Answers

Answer 1

Answer:

The options are missing, so I looked for similar questions.

the missing options are:

inflationtime preferencesrisk

the correct answer is inflation.

When investors purchase bonds, they are worried about the real interest rate that they will receive = nominal interest rate - inflation rate.

Sine the inflation rate is increasing, then the nominal rate must also increase in order to keep the real interest rate stable.

Explanation:


Related Questions

Jayhawk Company reports current E&P of $450,000 and accumulated E&P of negative $297,500. Jayhawk distributed $500,000 to its sole shareholder, Christine Rock, on the last day of the year. Christine’s tax basis in her Jayhawk stock is $48,250
1. How much of the $500,000 distribution is treated as a dividend to Christine?
2. What is Christine’s tax basis in her Jayhawk stock after the distribution?
3. What is Jayhawk’s balance in accumulated E&P on the first day of next year?

Answers

Answer:

1. The amount of the distribution treated as a dividend to Christine is equal to $450,000.

2. The amount of Christine’s tax basis in her Jayhawk stock after the distribution is equal to $0.

3. Jayhawk's balance in accumulated E&P on the first day of next year is equal to the negative $297,500.

Explanation:

1. How much of the $500,000 distribution is treated as a dividend to Christine?

The amount of the distribution treated as a dividend to Christine is the equal to the current E&P of $450,000 reported by Jayhawk Company.

2. What is Christine’s tax basis in her Jayhawk stock after the distribution?

This can b determined as follows:

Tax basis in Jayhawk stock after distribution = Max of (0, Current E&P + Previous tax basis - Distribution by Jayhawk') = Max of (0, $450,000 + $48,250 - $500,000) = Max of (0, - $1,750) = $0

Therefore, the amount of Christine’s tax basis in her Jayhawk stock after the distribution is equal to $0.

3. What is Jayhawk’s balance in accumulated E&P on the first day of next year?

Jayhawk's balance in accumulated E&P on the first day of next year is equal to the negative $297,500. This is because all the E&P of last year is paid as dividend.

1-a. Prepare a contribution format income statement for the game last year. 1-b. Compute the degree of operating leverage. 2. Management is confident that the company can sell 18,000 games next year (an increase of 3,000 games, or 20%, over last year). Given this assumption: a. What is the expected percentage increase in net operating income for next year? b. What is the expected amount of net operating income for next year? (Do not prepare an income statement; use the degree of operating leverage to compute your answer.)

Answers

Answer:

1-a. Total Contribution margin is $210,000 and Net operating income is $28,000.

1-b. Degree of Operating Leverage = 7.50

2-a. The expected percentage increase in net operating income for next year is 150%.

2-b. Expected amount of Net Operating Income is $70,000.

Explanation:

Note: This question is not complete. The complete question is therefore provided before answering the question as follows:

Magic Realm, Inc., has developed a new fantasy board game. The company sold 15,000 games last year at a selling price of $20 per game. Fixed costs associated with the game total $182,000 per year, and variable costs are $6 per game. Production of the game is entrusted to a printing contractor. Variable costs consist mostly of payments to this contractor.

Required:

1-a. Prepare a contribution format income statement for the game last year.

1-b. Compute the degree of operating leverage.

2. Management is confident that the company can sell 18,000 games next year (an increase of 3,000 games, or 20%, over last year). Given this assumption:

a. What is the expected percentage increase in net operating income for next year?

b. What is the expected amount of net operating income for next year? (Do not prepare an income statement; use the degree of operating leverage to compute your answer.)

Explanation of the answer is now provided as follows:

1-a. Prepare a contribution format income statement for the game last year.

The contribution format income statement for the game last year can be prepared as follows:

Magic Realm, Inc.

Contribution Income Statement

For Last Year

Details                               Total ($)       Per Unit ($)  

Sales                                 300,000              20

Variable cost                    (90,000)              (6)

Contribution margin         210,000               14

Fixed expense                 (182,000)

Net operating income     28,000  

1-b. Compute the degree of operating leverage.

Degree of Operating Leverage = Contribution Margin / Operating Income = $210,000 / $28,000 = 7.50

2-a. Management is confident that the company can sell 18,000 games next year (an increase of 3,000 games, or 20%, over last year). Given this assumption: What is the expected percentage increase in net operating income for next year?

Since:

Degree of Operating Leverage = Percentage change in Operating Income / Percentage change in Sales

Substituting the relevant values, we have:

7.50 =  Percentage change in Operating Income / 20%

Percentage change in Operating Income = 7.5 * 20% = 150%

Therefore, the expected percentage increase in net operating income for next year is 150%.

2-b. Management is confident that the company can sell 18,000 games next year (an increase of 3,000 games, or 20%, over last year). Given this assumption: What is the expected amount of net operating income for next year? (Do not prepare an income statement; use the degree of operating leverage to compute your answer.)

This can be calculated as follows:

Change in Net Operating Income = 150% * $28,000 = $42,000

Expected amount of Net Operating Income = Current Net Operating Income + Change in Net Operating Income = $28,000 + $42,000 = $70,000

The expected return on a portfolio: Group of answer choices can be greater than the expected return on the best performing security in the portfolio. can be less than the expected return on the worst performing security in the portfolio. is independent of the performance of the overall economy. is limited by the returns on the individual securities within the portfolio. is an arithmetic average of the returns of the individual securities when the weights of those securities are unequal.

Answers

Answer:

is limited by the returns on the individual securities within the portfolio

Explanation:

Portfolio is simply defined as a list of securities showing how much is (or will be) invested in each of them.

The expected return on a portfolio is calculated as the weighted average of the expected returns on the securities that the portfolio involves. The weight of each security is the a Portion or a fraction of wealth invested in that security. Expected return on a portfolio of N securities is: rp= sum (Xr).

Expected Return is usually based on anticipated income and anticipated capital appreciation.

from the video "the best stats you've ever seen "
what are some of the variables that rosling's graphs analyze? why are these factors important?​

Answers

Answer:

michael jackson it about life

Explanation:

The Jamison Company's inventory was destroyed on July 4, 2016, when its warehouse caught on fire early in the morning. Inventory was totally destroyed. The accounting records, which were located in a fireproof vault, contained the following information: Sales (1/1/16 through 7/3/16)$240,000 Purchases (1/1/16 through 7/3/16)180,000 Inventory (1/1/16)45,000 Gross profit ratio25% of cost Using the gross profit method, what is the estimated cost of the inventory that was destroyed by the fire

Answers

Answer:

$15,000

Explanation:

With regards to the above information, the estimated cost of inventory that was destroyed by fire is computed as

= [Sales - (Purchases + Inventory)]

Given that;

Sales 1/1/16 through 7/3/16 = $240,000

Purchases 1/1/16 through 7/3/16 = $180,000

Inventory 1/1/16 = $45,000

= [$240,000 - ($180,000 + $45,000)]

= $240,000 - $225,000

= $15,000

1A.) Assume a simple economy where only burgers are traded. In a year, 100 burgers are traded at the rate of $5 per burger. Assume two scenarios:

a. The economy has $100 in the form of 20 pieces of $5 bills.

b. The economy has $100 in the form of 100 pieces of $1 bills.

Calculate the velocity of money for both situations.

1B.) For a country A, the GDP growth rate is 8 percent and inflation is 4 percent. If the velocity of money remains constant, what is the change in real money balances?

Answers

Answer:

a. 5

b. 5

1B. 8%

Explanation:

a. MV = PY

Money Supply * Velocity of money = Price level * Real GDP

100 * V = 5 * 100

100V = 500

V = 5

b. Velocity = 5

It will not change because the money supply for both questions is the same = $100.

1.B. Change in real money balances = 8%

The change in real money balances will be the same as the GDP growth rate if velocity is constant.

Liberty Corporation was authorized to issue 300,000 shares of $5 par value common stock. Liberty issued 60,000 shares of common stock on January 15, 2020, at $15 per share. Required a. Record the entry on June 30, 2020, for purchase of 6,600 common shares for the treasury at $18 per share. b. Record the entry on September 20, 2020, for sale of 2,400 treasury shares at $21 per share. c. Record the entry on November 3, 2020, for sale of 1,500 treasury shares at $17 per share.

Answers

Answer:

Liberty Corporation

Journal Entries:

January 15, 2020:

Debit Cash $900,000

Credit Common stock $300,000

Credit Additional Paid-in Capital $600,000

To record the issue of 60,000 shares of common stock at $15 per share.

a) June 30, 2020:

Debit Treasury Stock $33,000

Debit Additional Paid-in Capital $85,800

Credit Cash $118,800

To record the purchase of 6,600 treasury shares at $18 per share.

b) September 20, 2020:

Debit Cash $50,400

Credit Treasury Stock $12,000

Credit Additional Paid-in Capital $38,400

To record the sale of 2,400 treasury shares at $21 per share.

c) November 3, 2020:

Debit Cash $25,500

Credit Treasury Stock $7,500

Credit Additional Paid-in Capital $18,000

To record the sale of 1,500 treasury shares at $17 per share.

Explanation:

a) Data and Analysis:

Authorized common stock share capital of 300,000 at $5 = $1,500,000

January 15, 2020: Issued 60,000 shares at $15 per share:

Cash $900,000 Common stock $300,000 Additional Paid-in Capital $600,000

June 30, 2020: Purchased 6,600 for the treasury shares at $18 per share:

Treasury Stock $33,000 Additional Paid-in Capital $85,800 Cash $118,800

September 20, 2020: Sale of 2,400 treasury shares at $21 per share:

Cash $50,400 Treasury Stock $12,000 Additional Paid-in Capital $38,400

November 3, 2020: Sale of 1,500 treasury shares at $17 per share:

Cash $25,500 Treasury Stock $7,500 Additional Paid-in Capital $18,000

A trade secret is a formula, device, process, method, or compilation of information that, when used in___________ , gives the owner an advantage over _______who do not know the ________information. In addition to considering the competitive advantage, a court will consider whether the information was , ________and___________ (and/or expensive) to obtain, when determining whether something is a trade secret. Another important consideration is whether the company made to __________protect it.
Fill in the blanks with words that would best complete the passage.
a. difficult
b. extraordinary efforts
c. interesting
d. the public domain
e. employees
f. commercial
g. reasonable efforts
h. desirable
i. conceal
j. readily available

Answers

Answer:

Business; competitors; secret; readily available; difficult; reasonable efforts.

Explanation:

A trade secret is a formula, device, process, method, or compilation of information that, when used in business, gives the owner an advantage over competitors who do not know the secret information.

In addition to considering the competitive advantage, a court will consider whether the information was, readily available and difficult (and/or expensive) to obtain, when determining whether something is a trade secret. Another important consideration is whether the company made reasonable efforts to protect it.

For example, the recipe and ingredients used in the manufacturing of popular soft drinks and alcoholic beverages is a trade secret that isn't known to many people around the world.

Societies choose what share of their resources to devote to consumption and what share to devote to investment. Some of these decisions involve private spending; others involve government spending. For each form of private spending, indicate whether it represents consumption or investment.
Private Spending Consumption Investment
People buying houses
People buying newspapers
People buying food
Firm buying trash cans
Firm buying computers
For each form of government spending, indicate whether it represents consumption or investment.
Government Spending Consumption Investment
Building tunnels
Buying medical equipment
Building public housing
Payment for public safety employees

Answers

Answer:

For each form of private spending, indicate whether it represents consumption or investment.

Private Spending

People buying houses     Investment

People buying newspapers    Consumption

People buying food     Consumption

Firm buying trash cans    Investment

Firm buying computers   Consumption

For each form of government spending, indicate whether it represents consumption or investment.

Government Spending

Building tunnels     Investment

Buying medical equipment     Investment

Building public housing     Investment

Payment for public safety employees  Consumption

Explanation:

Assume that a $1,000,000 par value, semiannual coupon US Treasury note with three years to maturity has a coupon rate of 3%. The yield to maturity (YTM) of the bond is 11.00%. Using this information and ignoring the other costs involved, calculate the value of the Treasury note:$960,214.55$504,112.64$680,151.97$800,178.79

Answers

Answer: $800,178.79

Explanation:

This is a semi-annual coupon bond so convert rate and period to semi annual rates.

Coupon payment = 3% * 1,000,000 * 1/2 years

= $15,000

YTM = 11%/2 = 5.5%

Number of periods = 3 years * 2 = 6 semi annual periods

Value of Bond = Present value of coupon payments + Present value of par

= 15,000 * ( 1 - ( 1 + 5.5%)⁻⁶) / 5.5%) + 1,000,000 / (1 + 5.5%)⁶

= 74,932.9546296555 + 725,245.8330245964

= $800,178.79

Assume that a business has $50000 of current assets and $40000 of current liabilities. What is the company’s current ratio?

Answers

Answer:

The company's current ratio is 1.25.

Explanation:

The current ratio is calculated by dividing the current assets by the current liabilities:

current assets=$50000

current liabilities=$40000

current ratio=$50000/$40000

current ratio=1.25

According to this, the answer is that the company's current ratio is 1.25.

One reason critics think advertising is wasteful is that: a. advertising is silent about things like product quality. b. businesses use deceptive methods of advertising which is harmful for consumers. c. large sums of money are spent on advertising that produces no consumer benefit. d. most ads are distasteful and send the wrong messages to consumers.

Answers

Answer:

c. large sums of money are spent on advertising that produces no consumer benefit

Explanation:

Critics consider advertising to be a waste because they believe that there is a large amount of financial resources being spent on advertising that will not be converted into benefits for the consumer, that is, they believe that it is a lot of money spent on communication marketing that it should be spent on product development, for example, in the form of converting investments into physical benefits that add greater value to the product and greater satisfaction for the consumer.

But a company that wants to become competitive and well positioned in the market, must allocate financial resources so that both things can be carried out, because advertising is extremely necessary to attract and retain potential consumers, since there is currently a great offer of them products available on the market and the company needs to develop a strategy that attracts consumers to its product, which can occur through well-developed advertising that generates consumer engagement and identification with the offered product.

Glenville Company has the following information for April:

Cost of direct materials used in production $48,000
Direct labor 59,000
Factory overhead 37,000
Work in process inventory, April 1 40,000
Work in process inventory, April 30 40,000
Finished goods inventory, April 1 29,000
Finished goods inventory, April 30 18,000

Required:
For April, determine the cost of goods manufactured.

Answers

Answer:

cost of goods manufactured= $144,000

Explanation:

Giving the following information:

Cost of direct materials used in production $48,000

Direct labor 59,000

Factory overhead 37,000

Work in process inventory, April 1 40,000

Work in process inventory, April 30 40,000

To calculate the cost of goods manufactured, we need to use the following formula:

cost of goods manufactured= beginning WIP + direct materials + direct labor + allocated manufacturing overhead - Ending WIP

cost of goods manufactured= 40,000 + 48,000 + 59,000 + 37,000 - 40,000

cost of goods manufactured= $144,000

Negotiations often involve three types of issues. For ______________ issues, the parties' preferences are directly opposed. For ______________ issues, the parties have directionally-opposed preferences but value the issues differently. For ______________ issues, the parties have the same preferences.

Answers

Answer:

1. Distributive issues

2. Integrative issues

3. Congruent issues

Explanation:

Typically, for every negotiation process, any of the three kinds of issues are involved, this includes the following distributive, congruent, and integrative issues.

Hence, Negotiations often involve three types of issues. For DISTRIBUTIVE issues, the parties' preferences are directly opposed. For INTEGRATIVE issues, the parties have directionally-opposed preferences but value the issues differently. For CONGRUENT issues, the parties have the same preferences.

For DISTRIBUTIVE issues, the parties' preferences are directly opposed.

For INTEGRATIVE issues, the parties have directionally-opposed preferences but value the issues differently.

For CONGRUENT issues, the parties have the same preferences.

What is a Negotiation?

A Negotiation refers to method through which parties settle their differences and in reaching an agreement.

Generally, for every negotiation process, any of the three kinds of issues are involved, this includes the following distributive, congruent, and integrative issues.

Read more about Negotiation

brainly.com/question/902450

On June 15, Oakley Inc. sells inventory on account to Sunglass Hut (SH) for $3,500, terms 2/10, n/30. On June 20, SH returns to Oakley inventory that SH had purchased for $800. On June 24, SH completely fulfills its obligation to Oakley by making a cash payment. What is the amount of cash paid by SH to Oakley

Answers

Answer:

$2,646

Explanation:

Calculation to determine the amount of cash paid by SH to Oakley

Cash paid=($3,500-$800)-[($3,500-$800)*2%]

Cash paid =$2,700-$54

Cash =$2,646

Therefore The the amount of cash paid by SH to Oakley is $2,646

your food-services company has been named as the sole provider of meals at a small university. the cost and demand schedules are for a single-price monopolist, the profit-maximizing price and number of meals per day is

Answers

Answer:

The answer is "400 meals at 2.50 dollars a day".

Explanation:

Please find the complete question and the solution in the attachment file.

In this question, when we compare the MR value as well as the MC, the monopolist produces up to the point where MR>MC.

In this, it happens before 400 meals at 2.50 per day and, so "400 meal at 2.50 dollars a day".

Scenario: You are in the market for a new car. You do not have a trade-in, but you have saved $3,000 toward a down payment. You currently earn $3,750.00 gross monthly income, of which 28% is withheld for various deductions. You have heard of the 20% rule of thumb, but want to limit your payments to no more than 18% of your net monthly income because of other debt commitments. You currently have a credit score of 685. You expect to drive the car an average 15,000 miles per year. You're considering purchasing a used-rather than new car. This strategy offers several advantages.
1. Which of the following is not an advantage of purchasing a used car?
A. The reduced down payment required for the purchase.
B. A lack of knowledge and confidence in the mechanical condition of the car.
C. The price of the automobile.
D. Avoidance of the vehicle's significant decrease in value due to depreciation.
2. Which of the following will directly affect the final cost of a new car if you elect to purchase the vehicle?
A. The amount of the trade-in on an existing vehicle (if applicable).
B. The color of the vehicle.
C. The extent to which you dress up when you negotiate the purchase.
D. The amount of any rebate or incentives associated with the purchase of the new vehicle.
E. The period or term of any loan used to finance the purchase.
3. Alternatively, after seeing several television commercials suggesting the benefits of leasing a new automobile, you’ve started thinking about the phenomenon of leasing. Which of the following statements regarding leasing is true?
A. If you select to use a closed-end lease, then you’ll be free from any final payment. That’s why they call it a walkaway lease.
B. Leasing can result in lower monthly payments than would be incurred if you purchased the vehicle.
C. Customary end-of-term charges on a lease can include a disposition fee, an early termination charge, and an excess mileage charge.
D. If you use an open-end lease, you’ll be required to pay the difference between the vehicle’s projected residual value and its actual market value.
E. Leases work best for people who want to drive a vehicle for years and years, and drive at least 30,000 miles every year.
4. A lease payment is based on four variables. Which of the following is not one of these variables?
A. The money, or lease, factor.
B. The vehicle’s residual value.
C. The closed-end premium.
5. Being upside down in a loan is the same as having:____.
A. Negative equity.
B. A negative interest rate.
6. Complete the following table to determine your desired maximum monthly payment.
Gross income (monthly) $
Deductions (dollar amount) $
Take-home pay $
Percentage allotted for car payment %
Maximum monthly payment $
7. You have decided to purchase a new car and have negotiated the price. A four-year loan is resulting in payments of $586.00 per month. How might you get your monthly payment down to your desired monthly goal?
A. Shop for a loan with a higher interest rate.
B. Extend the term of the loan from four to five years.
C. Shorten the term of the loan from four to three years.
D. Shop for a loan with a lower interest rate.
8. A good credit score is an important factor when buying a car because it allows you to (1)____obtain financing terms, and (2)_____afford a expensive or better vehicle for the same loan amount.

Answers

Answer:

Market for a New Car

1. A disadvantage of purchasing a used car:

B. A lack of knowledge and confidence in the mechanical condition of the car.

2. D. The amount of any rebate or incentives associated with the purchase of the new vehicle.

3. B. Leasing can result in lower monthly payments than would be incurred if you purchased the vehicle.

4. C. The closed-end premium.

5. Being upside down in a loan is the same as having:____.

A. Negative equity.

6. Gross income (monthly) $3,750

Deductions (dollar amount) $1,050

Take-home pay $2,700

Percentage allotted for car payment 18%

Maximum monthly payment $486

7. Using the savings towards a down payment can help reduce the monthly payment to $486 from $586.

Explanation:

a) Data and Calculations:

Savings towards down payment = $3,000

Gross monthly income = $3,750

Withholdings = 28%           1,050 ($3,750 * 28%)

Net after withholdings   $2,700

Payment for car

 limited to 18%                  $486

Net after car payment   $2,214

Adjustment for Accrued Expense
Joos Realty Co. pays weekly salaries of $17,250 on Friday for a five-day workweek ending on that day. Journalize the necessary adjusting entry assuming that the accounting period ends on Tuesday.
If an amount box does not require an entry, leave it blank. fill in the blank 2 fill in the blank 3 fill in the blank 5 fill in the blank 6

Answers

Answer and Explanation:

The adjusting entry is shown below:

Salary expense Dr ($17,250 ÷ 5 days × 2 days) $6,900

        To Salary payable $6,900

(Being salary expense is recorded)

here salary expense is debited as it increased the expense and credited the salary payable as it also increased the liabilities

Carter Corporation's partial income statement after its first year of operations is as follows: Income before income taxes $3,750,000 Income tax expense Current $1,035,000 Deferred 90,000 1,125,000 Net income $2,625,000 Carter uses the straight-line method of depreciation for financial reporting purposes and accelerated depreciation for tax purposes. The amount charged to depreciation expense on its books this year was $2,400,000. No other differences existed between book income and taxable income except for the amount of depreciation. Assuming a 20% tax rate, what amount was deducted for depreciation on the corporation's tax return for the current year

Answers

Answer: $2,850,000

Explanation:

The amount was deducted for depreciation on the corporation's tax return for the current year will be calculated as:

Defered income tax = $90,000

Tax rate = 20%

We will calculate the difference between the book income and the taxable income which will be:

= $90000 ÷ 20%

= $90000 × 100/20

= $90000 × 5

= $450000

Therefore, the amount that was deducted for depreciation on the corporation's tax return for the current year will be:

= $2,400,000 + $450,000

= $2,850,000

A US company makes furniture and uses large amounts of exotic woods. How will quotas on imported wood affect he price of the product and the
marketing plans?

Answers

Answer: See explanation

Explanation:

A quota is simply referred to as a limited quantity of a product that can either be produced in a country or imported or exported under official controls. A quota is usually done to limit importation of goods and encourage local production.

Since the US company makes use of large amount of exotic goods which are usually imported, this will bring about a reduction in the supply of furniture as there'll be decrease in wood.

This will hence lead to an increase in price of the available furniture. This will certainly have a negative effect on the marketing plan of the company.

Provide an example of two companies that have built in effective co-opetition. Briefly explain the benefit of the relationship describe one job that once existed but today is obsolete or slowly becoming obsolete because of technology provide an exampled of two companies that have built a strategic alliance. Briefly explain the benefits of the relationship.

Answers

Answer:

Microsoft and Apple, Samsung and sony.

Explanation:

Samsung electronics and sony formed an agreement in 2004 for use of shared knowledge and resources in designing flat television screens.  A strategic alliance is a collaboration or a synergy where each partner gets the benefits of the alliance. Jobs such as travel agencies, cashiers, textile workers.  A strategic alliance consists of healthy behavior, long terms goals, and better customer satisfaction.

You are planning to save for retirement over the next 35 years. To do this, you will invest $710 per month in a stock account and $310 per month in a bond account. The return of the stock account is expected to be 9.1 percent, and the bond account will earn 5.1 percent. When you retire, you will combine your money into an account with an annual return of 6.1 percent. Assume the returns are expressed as APRs.

How much can you withdraw each month from your account assuming a 30-year withdrawal period?

Answers

Answer:

monthly payment = $16,162.87

Explanation:

future value of stock account = $710 x= [(1 + 0.00758333)⁴²⁰- 1 ] / 0.00758333 = $2,142,045

future value of bond account = $310 x= [(1 + 0.00425)⁴²⁰- 1 ] / 0.00425 = $360,116

future value = $2,502,161

PVIFA = [1 - 1/(1 + 0.0050833)³⁶⁰ ] / 0.0050833 = 165.019

monthly payment = $2,502,161 / 165.019 = $16,162.87

The Mighty Music Company produces and sells a desktop speaker for $100. The company has the capacity to produce 50,000 speakers each period. At capacity, the costs assigned to each unit are as follows: Unit level costs $ 45 Product level costs $ 15 Facility level costs $ 5 The company has received a special order for 500 speakers. If this order is accepted, the company will have to spend $15,000 on additional costs. Assuming that no sales to regular customers will be lost if the order is accepted, at what selling price will the company be indifferent between accepting and rejecting the special order

Answers

Answer:

$75

Explanation:

Calculation to determine what selling price will the company be indifferent between accepting and rejecting the special order

Using this formula

Selling price between accepting and rejecting the special order= ( Additional cost ÷ Units sold number) + Unit level Cost

Let plug in the formula

Selling price between accepting and rejecting the special order= ( $15,000 ÷ 500 ) + $45

Selling price between accepting and rejecting the special order= $30 + $45

Selling price between accepting and rejecting the special order= $75

Therefore The selling price that the company will be indifferent between accepting and rejecting the special order is $75

Which of the following addresses the economic question of how to produce?
a. growing corn instead of potatoes
b. requiring individuals to complete specific types of work
c. producing more capital goods and fewer consumer products
d. selling natural resources to other countries

Answers

Answer:

b. requiring individuals to complete specific types of work

Explanation:

Among the following options, the statement that addresses the economic question of how to produce is "requiring individuals to complete specific types of work"

This is because as a producer one may choose to use either a certain individual to complete a specific type of work or employ the service of machinery, an ex-pat from another country, or just a technical expert in a government-funded organization.

Therefore, each of the options will yield a different cost to the producer.

Village Bank has $310 million worth of assets with a duration of 12 years and liabilities worth $248 million with a duration of five years. In the interest of hedging interest rate risk, Village Bank is contemplating a macrohedge with interest rate T-bond futures contracts now selling for 104-20 (30nds). The T-bond underlying the futures contract has a duration of eight years. If the spot and futures interest rates move together, how many futures contracts must Village Bank sell to fully hedge the balance sheet? (

Answers

Answer:

2129  futures contracts to be sold

Explanation:

Asset worth = $310 million

Asset duration = 12 years

liabilities = $248 million

Liabilities duration = 5 years

T-bond futures contracts = 104-20 (30nds)

% of assets = 310 / 248 =

Determine how many futures contracts Village Bank will sell to fully hedge the balance

Number of Contracts = -[Assets * (Asset Duration – (Liabilities Duration * % of Assets) / (Duration * Contract Value)]

 = - [ 310 * ( 12 - ( 5 * (310/248)) / ( 8 * ( 104 + ( 20/30)) ]

= - [ 310 * ( 12 -  6.25 ) / ( 8 * 104.6667 ) ]

= - [ 310 * 5.75 / 837.3336 ]

= - 2.12878 * 1000

= 2128.78 ≈  2129 ( number of futures contracts to be sold )

Beck Manufacturing reports the following information in T-account form for 2019. Raw Materials Inventory Begin. Inv. 11,600 Purchases 57,000 Avail. for use 68,600 DM used 48,000 End. Inv. 20,600 Work in Process Inventory Begin. Inv. 16,000 DM used 48,000 Direct labor 31,100 Overhead 57,000 Manuf. costs 152,100 Cost of goods manuf. 138,200 End. Inv. 13,900 Finished Goods Inventory Begin. Inv. 17,200 Cost of goods manuf. 138,200 Avail. for sale 155,400 Cost of Goods Sold 136,500 End. Inv. 18,900 Required: 1. Prepare the schedule of cost of goods manufactured for the year. 2. Compute cost of goods sold for the year.

Answers

Answer:

Beck Manufacturing

1. Schedule of the Cost of Goods Manufactured for the year:

Beginning WIP Inventory              16,000

Direct Materials used                   48,000

Direct labor                                     31,100

Overhead applied                        57,000

Total manufacturing costs          152,100

Less Ending WIP Inventory          13,900

Cost of goods manufactured   138,200

2. Cost of goods sold for the year:

Beginning Finished Goods        17,200

Cost of goods manufactured 138,200

Goods available for sale         155,400

Less Ending Finished Goods   18,900

Cost of Goods Sold               136,500

Explanation:

a) Data and Calculations:

T-account form for 2019.

Raw Materials Inventory

Account Title     Debit    Credit

Begin. Inv.         11,600

Purchases       57,000

DM used                        48,000

End. Inv.                         20,600

Avail. for use  68,600   68,600

Work in Process Inventory

Account Title     Debit    Credit

Begin. Inv.        16,000

DM used         48,000

Direct labor      31,100

Overhead       57,000

Cost of goods manuf. 138,200

End. Inv.                         13,900

Manuf. costs 152,100  152,100

Finished Goods Inventory

Account Title     Debit    Credit

Begin. Inv.          17,200

Cost of goods

manufacture  138,200

Cost of Goods Sold      136,500

End. Inv.                           18,900

Avail. for sale 155,400 155,400

define foreclosure economics.​

Answers

Answer:

Foreclosure is the legal process by which a lender attempts to recover

Explanation:

Froggatt Enterprises,a premier educational products company, experiences ups and downs in demand each year corresponding to major school holidays. The company maintains a steady workforce and uses overtime, inventory, and subcontracting to absorb fluctuations in demand. Expected demand, available capacities, and costs for the next four quarters are given below. There is no beginning inventory. Design a production plan that will satisfy demand at minimum cost.

Period Demand Regular Capacity Overtime Capacity Subcontracting Capacity
1 600 1000 500 500
2 2100 1000 500 500
3 800 1000 500 500
4 1800 1000 500 500


Regular production cost per unit $8
Overtime production cost per unit $10
Subcontracting cost per unit $12
Inventory holding cost per unit per period $1

Answers

Answer:

Answer is explained in the explanation section below.

Explanation:

Note: As this question contains tables, here I cannot insert table properly, so I have done it on excel spreadsheet and it is attached in the attachment below.  Please refer to the attachment below for the minimum cost production plan.

Please refer to Attachment.  

Priority should be given in the order mentioned below.

1. Maintain maximum capacity output even though demand is lower for the period because demand for the next period is higher and inventory holding costs are only $1 per unit per period.

2. Over time output for remaining demand, including demand for the following year, since it is less costly than subcontract production and inventory keeping costs are just $1 per unit per period.

3. There is no obligation for output to be subcontracted.

Explain why effective critical thinking is important for high self-esteem?

Answers

Answer:

Critical thinking help you to be active and love what you do. Therefore it call critical thinking

Which of the following industries is most likely to outsource jobs to another country because of slight increases in labor costs?

a. Milk dairy.
b. High-tech research facility.
c. Textile plant.
d. Automobile assembly plant.

Answers

Which of the following industries is most likely to outsource jobs to another country because of slight increases in labor costs?

a. Milk dairy.

b. High-tech research facility.

c. Textile plant.

d. Automobile assembly plant.

Answer: c. Textile plant.

Hope this helps

Other Questions
What is an example of biotechnology? who is VluspPlease help ASAP!!!!! What is the strongest piece of evidence in the second paragraph of thearticle by Douglass?A)greatness in the ability to organizeB) greatness in the ability to discover truthTheodore Parker's three grades of human greatnessD) greatness in executive and administrative ability PLEASE HELP ME IM GIVING EVERTYTHING FOR THISAll About Me Graffiti Wall PowerPointWorth 25 PointsDue Thursday, April 1, 2021 i dunno TvTSAYS I NEED MORE WORDS OK HERE I AM what does martin luther king jr urge americans to do after police attack protestors on the bridge Please complete the following DNA strands1. AGGTCCAAGCTCAAATTTCCCC2. GAAACCCCTTAAACCTTAATTCC3. GCGCGCGCAAATTTTTCCCATCTPlease complete the following strands using RNA:1. AGGTCCCAAAGGCCCTTTCC2. UAAAGGGCCCAGCCCACC3. CUAAAAGGGGGUUUUAACC Can someone plzzzz help meeee!!!!! Wayne charges the following for repairing washing machines:28 call-out charge + 16 for each half-hour he spends on the repairIf a repair costs 76, how long did it take? 103+1793=????????what is the answer?? Answer both parts please Helpppp me pleaseee Create a complete sentence from each of the following phrase fragments. Add capitalization and punctuation wherever necessary.EllenExample1. has been a gymnast.managing the store International trade theory attempts to explain why nations trade and to help predict the direction, composition, and volume of goods that will be traded A variety of different theories have been proposed over the past several centuries to help explain the existence of trade between nations and to help predict whether trade will occur, what products or services will be traded, the direction of this trade, and the volume of this trade. Understanding the differences between these theories helps managers and policy makers to understand whether and how to pursue trade opportunities internationally Drag each of the general characteristics listed to the international trade theory that it is most associated with:International Trade Theory General Characteristics Government stimulates trade by means of protectionism Mercantilism Factors that can drive competitive advantage for one economy over another Absolute Advantage Trade influenced by relative income levels Comparative Advantage Trade materials that are abundant Trade most efficiently produced goods Differences in Resource Endowments Overlapping Demand Trade goods and services at a lower opportunity cost than others Diamond Model of National Competitive Advantage Why did the cost of spices decreased so much? Who's the first person to reach the moon how a positive personal lifestyle plan may promote meaningfulness of life Which of the following would be a good hook for a personal essay? Jim began a 222-mile bicycle trip to build up stamina for a triathlete competition. Unfortunately, his bicycle chain broke, so he finished the trip walking. The whole trip took 8 hours. If Jim walks at a rate of 5 miles per hour and rides at 33 miles per hour, find the amount of time he spent on the bicycle. Find the unit rate.15 plants in 5 rows = BLANK plants per row