Do you think cystic fibrosis or muscular dystrophy, genetic disorder, would show up in a person's DNA fingerprint profile? Explain your Reason Please.

Answers

Answer 1

Answer:

we can find such type of genetic disorders through pedigree chart.

Explanation:

cystic fibrosis is a Autosomal recessive disease

Muscular dystrophy is a Autosomal dominant disease.we can see them by observing the next generations going on .we can't find them in person's DNA fingerprint profile.


Related Questions

Shivering and vasoconstriction would be signaled to cause a: A. increase in pH. B. decrease in temperature. C. decrease in pH. D. increase in temperature.

Answers

Answer:D

Explanation: shivering occurs when someone is cold and vasoconstriction is when the blood vessels close to the skin and the veins closer to the skin surface constrict as a result of dat air doesn’t enter the body

Vasoconstriction is the narrowing of the blood vessels that hinders blood flow. Vasoconstriction and shivering will lead to an increase in the temperature through thermoregulation. Thus, option d is correct.

What is thermoregulation?

Thermoregulation is the maintenance and balancing of the temperature and heat in the body. They are regulated by many factors including shivering and vasoconstriction.

During the vasoconstriction, the blood vessels close to the skin surface close and the body shivers as a result of cold or decreased temperature. This signals the body to increase the temperature so that shivering can be stopped.

Therefore, vasoconstriction and shivering signal the body to increase the temperature.

Learn more about thermoregulation here:

https://brainly.com/question/7450241

#SPJ2

Name four breeds of cattle

Answers

Answer:

Black Angus, Red Angus, Holstein, Gelbvieh

Hope this helps!

The hypothalamic hormone that triggers the secretion of FSH and LH from the anterior pituitary is

Answers

Answer:

Hypothalamic-Pituitary-Gonadal Axis

GnRH produced by the hypothalamus stimulates the production of both LH and FSH. FSH functions by stimulating ovarian follicular development in females and regulating spermatogenesis in males. LH induces ovulation and corpus luteum formation in the ovaries.

plz give brainlist

hope this helped

When human skin suffers a cut, the process of healing rapidly begins allowing for wound closure and healing within a few days. Keloids occur when skin around wounds continues to grow after the skin has healed. A disruption in the regulation of which cellular process is probably responsible for this condition

Answers

Options

A. Mitosis

B. Meiosis

C. Apoptosis

D. Phagocytosis

Answer:

A

Explanation:

Mitosis is a type of cell division which takes place in living  organism during growth and development.Therefore it is ensures  the regenerations of cells and tissues during healing.

Therefore the restoration of new cells to the skin following injuries is due to mitosis.Since this is a multiplication division(2n) in which the daughter cells are exactly like the parents' cells the new tissues of the skin by mitosis, look exactly like the previous one that was injured.

In cases where the mitotic growth control is lost, the scare tissues of the injured part overgrows with granulation tissues and this leads to Kaloids.

      Its is a mass of Collagen Type 1.(Collagen is an  fibrous proteins  which has largest proportion in mammals).

Keloids  is characterized with pink or red coloration and elevation of the area,excessive growth of the area, with irritating  patch skin

Which statements accurately describe the roles of water on earth

Answers

Answer:

C.

Explanation:

It carries cold water from the equator to the poles

PLEASE ANSWER ASAP!!!!!!!! ITS DUE IN 5 MINUTES.

1.) How do organisms benefit from Mitosis? Write a paragraph using at least five sentences.


Answers

Answer:

Organisms benefit from mitosis because mitosis helps regenerate cells. This helps them recover from injuries and more.

Explanation:

Beyond changes in relationships described above, explain what other characteristics of man changed after the Fall.

Answers

Answer:

The consequences of the fall was man and woman will die man turned to mortal and will turn back into dust. woman would bring children in pain. relationships between husband and wife would be difficult. The ground was cursed labor would be very hard. human was banned from the paradise and the garden. no longer would they enjoy the holiness and justice they had in paradise.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.

Answers

Answer:

Scientific knowledge develops through making observations about the natural world. An observation may generate a scientific question, which may lead to a hypothesis. The hypothesis can be tested through experimentation. The results of experimentation lead to changes in scientific knowledge.

Explanation:

Explain how scientific knowledge develops through making observations about the natural world.  my answers are never wrong trust me

Write TRUE or FALSE
(a)
A 'system' is the part of an organism that carries out a certain function.​

Answers

Answer:

TRUE

Explanation:

Please I need help with this

Answers

TAAGCCGATAAATGCTAACGGTA

Muscle cell are richer in lysosomes , as they require lot of energy. correct and rewrite the following statement.

Answers

Answer:

See below

Explanation:

The correct statement is:

=> Muscle cells are richer in mitochondria, as they required lots of energy.

Mitochondrion acts as power house of the cell providing the cell with the required energy.

Correct Statement:-

Muscle cells are richer in Mitochondria, as they require a lot of energy.

[tex] \large{ \underline{ \boxed{ \pink{ \rm{Explanation}}}}}[/tex]

Especially in Skeletal muscles, Mitochondria and glycogen granules are found in abundance. Our limbs that includes our arms and legs shows movement which needs energy. The food is oxidized and energy is released.

More to know:-Mitochondria is popularly known as Power house of the cell or ATP generation site.It is a double-membranous structure with outer membrane smooth and inner membrane surrounds the matrix.The inner membrane have cristae which increase surface area.The cristae bear Oxysomes or F0-F1 particles.Mitocondria is semi-autonomous, it have it's own DNA and ribosomes.

━━━━━━━━━━━━━━━━━━━━

Drag each label to the correct location. Classify the interactions as being direct or indirect competition. Two eagles fight over a salmon carcass. All the gray foxes in a habitat prey primarily on penguins. Two colonies of black ants clash over a wasp. Gray squirrels in an area rely on nuts for food.

Answers

Answer:

Two eagles fight over a salmon carcass- DIRECT

All the gray foxes in a habitat prey primarily on penguins- INDIRECT

Two colonies of black ants clash over a wasp- DIRECT

Gray squirrels in an area rely on nuts for food- INDIRECT

Explanation:

Living organisms of same or different species tend to interact with one another in their natural habitat. One of those interactions is competition, which occurs when living organisms share the same limited resources or occupy the same niche in their habitat.

However, competitive interaction between organisms can either be direct or indirect. Direct interaction is that which involves a physical interaction between the organisms i.e. a confrontation. A struggling for the limited resource is evident. For example, two eagles fighting over a salmon carcass and two colonies of black ants clashing over a wasp shows the form of physical confrontation for the limited resource between the organisms involved. Hence, they are examples of direct competition.

On the other hand, indirect competition involves the competition for a limited resource without a physical confrontation or struggle. Organisms make use of the limited resource until it becomes unavailable to competitors. For example, gray foxes in a habitat that prey primarily on penguins and gray squirrels in an area relying on nuts for food shows a competition for a scarce resource without any physical interaction between them. Hence, they are examples of indirect competition.

Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

The dark organelles labelled E is called the Ribosomes.    

The answer is Ribosomes

Is there just one universal scientific method?

Answers

Answer:

There is no such unique standard method—scientific progress requires many methods—but students in introductory science courses are taught that `The Scientific Method' is a straightforward procedure, involving testing hypotheses derived from theories in order to test those theories.

Explanation:

what mode of nutrition is house fly​

Answers

Answer:

Houseflies do not have chewing mouthparts like a cockroach or piercing-sucking mouthparts like a mosquito. They regurgitate digestive enzymes, soften and liquify the food material, and then they sop it up with their sponging mouthparts.

Hope this makes sense and helps

a pupil performed an experiment in a school lab to show the action of a digestive enzyme on a food substance

a) Name and enzyme suitable for such an experiment
b) Name a food substance on which the enzyme that you have named will act
c) Describe any preparation of the food required before the experiment is performed. If no preparation is required state why?
d) give the temperature at which the enzyme-food mix should be maintained for the experiment to work
e) how much time is needed for digestion of food in this experiment?
f) describe a test to confirm that digestion has occurred ​

Answers

I prefer d as the correct answer!!!

Which of the following is a testable hypothesis?
a. Roses are more beautiful than violets.
b. A plant needs at least five hours of sunlight per day to grow.
c. I've cream is delicious.
d. Humans will someday land on Mars.

Answers

Answer:

D. Humans will someday be on mars

nope, the only one you can test would be B, because the others are opinions or something in the future

In brief state what happens when a) dry apricots are left transferred to sugar solution? b) a Red Blood Cell is kept in concentrated saline solution? c) the Plasma-membrane of a cell breaks down? d) rheo leaves are boiled in water first and then a drop of sugar syrup is put on it? e) golgi apparatus is removed from the cell?

Answers

Answer:

Explanation:

 (a) Dry apricots when placed in pure water swell due to osmosis and when in sugar water, they shrink again.

(b) When a Red Blood Cell is placed in concentrated saline solution exosmosis occurs and the RBCs shrink due to excess loss of water.

(c) Breaking of the plasma membrane leads to the scattering of the ceil organelles as it forms the basic supporting unit of the cell.

(d) When Rheo leaves are boiled in water first and then a drop of sugar syrup is put on it, osmosis does not occurs, due to the death of the cells of the leaf. This shows that selective permeability is property of living plasma membrane.

(e) Golgi complex helps in the package, storage and transfer of proteins synthesized by ribosomes. Thus, when ribosomes are removed the cell will not function properly

Which statement is always true when describing sex-linked inheritance? It results in a dominant trait. The alleles are found on the X or Y chromosome. The resulting trait is influenced by multiple alleles. It is affected by alleles on at least three different chromosomes.

Answers

Answer:

the second one

Explanation:

there are only 2 sex linked chromosomes and that is X and Y

The true statement when describing sex-linked inheritance is ; ( B ) The alleles are found on the X and Y chromosome

The alleles responsible for reproductive inheritance from parents to offspring is contained in the X and Y chromosome of the reproductive gametes.

The female gametes contains double X chromosomes while the male reproductive gametes contains one X and one Y chromosomes. The alleles that are responsible for inheritance ( i.e. the sex of the offspring ) are contained in this chromosomes.

Hence we can conclude that The true statement when describing sex-linked inheritance is the alleles are found on the X and Y chromosome.

Learn more : https://brainly.com/question/24395447

In the database, Academic Search Complete (Links to an external site.), search for the article "Brevetoxicosis: Red Tides and Marine Mammal Mortalities" by Flewelling et al. If you wanted to explore more of the scholarly conversation by taking advantage of "citation chaining" what links could you click on to help with this task

Answers

Answer: The link I would be clicking on with this task is Molecular detection of the brevetoxin-producing dinoflagellate Karenia brevis and closely related species using rRNA-targeted probes and a semiautomated sandwich hybridization assay. Therefore, the task will be accomplished having done this.

True or False: Polar molecules do not have a difference in electrical charge.

Answers

Answer:

false

Explanation:

nonpolar molecule has no separation of charge, so no positive or negative poles are formed

SIOM CSserials
What has a greater influence on protein levels?
(1 point)
Protein degradation has a greater influence because outside factors like antibiotics can
cause it, and it is difficult to recover from.
O
Protein degradation has a greater influence because they are denatured faster than the cell
can produce them.
mRNA destroyer concentration has a greater influence because it is destroying mRNA before
proteins can even be produced.
mRNA destroyer concentration has a greater influence because mRNA is destroyed right
after the proteins are produced.

Answers

Answer:

mRNA destroyer concentration has a greater influence because it is destroying mRNA before  proteins can even be produced.

Explanation:

Proteins are synthesized from mRNA through the process of translation. mRNAs are first synthesized from a coding DNA template through the process of transcription. Hence, if mRNAs are destroyed, it means proteins will not be synthesized at all.

Protein not being synthesized at all means that mRNA destroyer concentration has a greater influence on protein levels than protein degradation. With protein degradation, not all the protein is degraded at once and some quantity of the protein can still be found, but with mRNA destroyer concentration, no protein can be found at all because it was not synthesized in the first place.

How are the proteins inside your body affected by the presence of water and other molecules?

Answers

Answer:

Our body is constitute of several essential molecules such as proteins, fat, carbohydrate, water, and other molecules.

Each molecule has some of the impact of other molecules in the body. Impact of water and other molecules on proteins inside the body are as follows:

Proteins have ligand-binding site and water provide stability to the ligand-binding site of proteins through its hydrogen bonds.Conformational flexibility and transitions of proteins are due to the presence of water molecules in it.Disbalance in the pH of body due to changing concentration of sodium-potassium ions can denature the protein. Enzymes present in the body can control the rate of formation of proteins in the body.


1. If the temperature of the water increases from 5°C to 10°C, the goldfish in Population 1 would most likely

Answers

Answer:

hot water make it hard for fish to breathe

Explanation:

an increase in temperature of water will  reduced the dissolved oxygen in water and increase the metabolic rate of goldfish thus causing goldfish respiration rate

Question What was the ratio of tall to short plants in the F2 generation of Mendel's experiments? A. 3:1 B. 2:1 O C. 1:1 D. 6:1 ​

Answers

Answer:

A

Explanation:

Answer: 3:1

Explanation:

i got it right on the test

Can someone describe these:
Menstrual Phase
Follicular Phase
and Luteal phase

Thanks!!!

Answers

Answer:

(menstrual phase) this is the phase where the unfertilized ovum and endometrium that was formed in readiness for implantation slough off or come out due to a sudden drop in progesterone levels

(follicular phase) this is where the graafian follicle in the ovary develops. from primary follicles due to secretion of follicle stimulating hormone by the pituitary gland and matures there after due LH hormone which will also stimulate the ovary to release the ovum

(luteal phase)this is the phase after the ovum has been released where the remains of the ruptured graafian follicle undergo reorganization to form a corpus luteum/yellow body which now produces progesterone which causes thickening of endometrium in readiness for implantation

hope this helps

Answer:

The menstrual cycle is the regular natural change that occurs in the female reproductive system that makes pregnancy possible. 2) The follicular phase is a phase of the estrous cycle during which follicles in the ovary nature from primary to a fully mature grafian follicle.It ends with ovulation.3) The luteal phase begins during the second half of a menstrual cycle normally lasting around 12 14 days after the ovulation and it is responsible for producing progesterone.

13. List 4 safety symbols that would be seen if you are working with a material that is biohazard, such as bacteria.

Answers

Answer:

1. Skull and crossbones

2. A triangle (commonly painted colour red or yellow) with an exclamation sign inside.

3. biohazard symbol

4. A radiation sign in the form of a triangle, having other little image descriptions inside.

Explanation:

Note that a biohazard material refers to dangerous substances of biological (living) nature that can pose a threat to humans. Thus, safety symbols try as much as to draw attention to the descriptions used.

For example, skull and crossbones and biohazard symbols are used to indicate that a material that is biohazard, such as bacteria could result in the death of a person.

Which structure is located between the trachea and a bronchiole? A. epiglottis B. pharynx C. alveolus D. bronchus

Answers

the correct answer is the bronchus

Consider this animal cell. The organelles in an animal cell are labeled. Part E represents small dots on the nucleolus. What is the function of the small, dark organelles labeled E? They contain enzymes for the digestion of old cell parts. They regulate what enters and leaves the cell. They produce proteins for the cell. They store water and other materials.

Answers

The dark organelles labelled E is called the Ribosomes.

Answer:

C

Explanation:

Edge 2020

1. ____Bacteria are the only microorganisms used in the fermentation process 2. ____Fermentation can be used only to make dairy products 3. ____Starter cultures are used to initiate the process of fermentation in modern day food processing 4. ____Fermentation occurs when undesirable metabolic reactions allow for the growth of pathogens or the presence of unwanted microorganisms in food

Answers

Please sort the following statements as being true or false regarding fermentation and its role in food production. Please recall the role that microorganisms can play in the production of foods.

Answer:

1.  False statement

2.  False statement

3.  True statement

4.  False statement

Explanation:

1. Yeast is a microorganism which is also used in fermentation process.

2. Fermentation can however be used for various reasons, including: development of flavours, preservation and enrichment of foods, reduction of food cooking time etc.

3. Starter culture is considered to be a form of microbiological process which is used to initiate a process of fermentation.

4. Fermentation is considered to be a desired action of microorganisms

Statement that Bacteria are regarded as only microorganisms utilized in fermentation process is False

Statement that Fermentation is considered only when making dairy products is False.

Statement that Starter cultures can be utilized when initiating the fermentation process in food processing in this age is True.

Statement that Fermentation takes place when growth of pathogens or unwanted microorganisms in food are allowed by undesirable metabolic reactions is False.

Fermentation can be regarded as metabolic process whereby  organism converts a carbohydrate into alcohol or an acid.

This process is used in making dairy products, one of the organisms that can be used in fermentation is yeast.

Learn more at:

https://brainly.com/question/13050729?referrer=searchResults

Other Questions
please please help!! In a burnt offering, the animal was cut up into pieces and carefully arranged on the altar. True False Write an equation in slope-intercept form for the line the road will follow. (The road is the dashed line.) Suppose that the central bank must follow a rule that requires it to increase the money supply when the price level falls and decrease the money supply when the price level rises. If the economy starts from long-run equilibrium and aggregate demand shifts right, the central bank must If a^b= b^a and a = 2b then find the value of a^2+b^2a) 20b) 30c) 28d) 24 The arc length apothem shown below is 15 feet. Part 1) State the equation that relates arc length to central angle. Part 2) Find the angle apothem in radians. Part 3) Convert your answer from Part 2 to degrees and write it to the nearest hundredth of a degree which of the following best explains why it is important to protect rivers "A 25-year old client with a low risk tolerance wishes to invest in bonds. The client has invested in equities before, but has no experience investing in bonds. The BEST recommendation would be:" Find the measure of c. You are considering purchasing stock in Canyon Echo. You feel the company will increase its dividend at 4.4 percent indefinitely. The company just paid a dividend of $3.29 and you feel that the required return on the stock is 10.6 percent. What is the price per share of the company's stock? Why did many Americans purchase stocks at this time? In 2019, Tim sells Section 1245 property for $28,000 that he had purchased in 2009. Tim has claimed $5,000 in depreciation on the property and originally purchased it for $15,000. How much of the gain is taxable as ordinary income? 7x-2-3xIm trying to combine like terms facists differed communism because facists? A) B) C) D) g You can find the results of the seedling experiment hereLinks to an external site.. Carry out the hypothesis test that you have identified in the previous problem; which is closest to the p-value that you obtain?Group of answer choices0.040.080.090.61 3(x6)=18 help plese find the slope of the line y = 4 What is the volume of the composite figure?Answers:192ft^396ft^376ft^3152ft^3 "The Elevator" by William Sleator, what are major things that happened, and what would be different if said thing never happened in the story? Based on the passage, which to conclusions can you draw about religion in ancient EgyptPlato