Do not capitalize every word, unless that is the style of your publication.
True
False

Answers

Answer 1

Answer:

true

Explanation:

Answer 2

Answer:

True

Explanation:

U have to capitalize every word u write or type (it's also option) u dont' have too capitalize every word u write or type


Related Questions

Using the sentence context, determine the meaning of the word "copious" in the following example.
Given that Arturo has read more than 23 books about volcanoes, his knowledge about the eruption of Mount
Vesuvius is copious.
abundant
limited
impressive

Answers

The answer is limited.
Copious means to be full or abundant. Arturo has enough knowledge about volcanoes which helps him know more about the mount Vesuvius eruption. Looking at our choices, we can cross limited out. He knows a lot and can go further more if he wanted to, so the answer is abundant.

Under line the examples of "radiation"
"light bulb giving off heat"
"cuddling with your warm dog"
"feeling heat while standing by campfire"
"smoke rising from a fire"
"sun heating a car"
"cooking pancakes in a pan"

Answers

Answer:

"light bulb giving off heat"

"feeling heat while standing by campfire"

"sun heating a car"

Explanation:

Radiations is one of the modes of heat transfer. Radiation involves the transfer of heat without a material medium for propagation of heat. In other words, radiation does not need matter to move from one point to another.

The following are examples of radiation;

"light bulb giving off heat"

"feeling heat while standing by campfire"

"sun heating a car"

an unforgettable incident in my life simple short essay for children ​

Answers

Answer:

can you explain this and I'll write your essay

can it be of abuse? or something like non triggering?

Rewrite this passage so that it includes at least one compound, complex, or compound-complex sentence.
You should not get up. You should not make dinner. You think you feel fine. You need to stay in bed. You are sick. You need to give your body a chance to get well. You will only get better with rest.

Answers

Answer:

You should not get up. You should not make dinner. You think you feel fine, but you should stay in bed. You are sick. You need to give your body a chance to get well; you will only get better with rest.

Answer:

I need points sorry

Explanation:

Which of the following sentences does not have parallel structure?
Group of answer choices

Both of these.

None of these.

Either I will or I won’t.

I hope to vacation either in Spain or Ireland.

Answers

I think it is the last sentence but I might be wrong

Which excerpt from "The Most Dangerous Game" is an example of foreshadowing?
"Can't see it," remarked Rainsford, trying to peer through the dank tropical night that was palpable as it pressed its thick warm blackness in upon the yacht.
Who cares how a jaguar feels? The world is made up of two classes--the hunters and the huntees. Luckily, you and I are hunters.
I hope the jaguar guns have come from Purdey's. We should have some good hunting up the Amazon.
I've seen you pick off a moose moving in the brown fall bush at four hundred yards, but even you can't see four miles or so through a moonless Caribbean night."

Answers

The second because it shows zaroffs idea of darwinism.

Answer:

Who cares how a jaguar feels? The world is made up of two classes--the hunters and the huntees. Luckily, you and I are hunters.

Explanation:

Why is it important to express love and affection to young children?

Answers

Answer:

Young children need love and affection to grow and succeed in life. Some studies proved that a lack of parental warmth and love can make children more stressed since parents put too much pressure on them to succeed without balancing it with affection. Love and affection help children to feel secure regardless of their accomplishments. This builds their confidence and self-esteem.

Explanation:

what are you doing today?

Answers

crying because i hate my math

Answer:

I'm just doing homework. if we're getting into specifics then I'm working on a map, biology thing, and something with health. I might also read a book just to prove someone wrong.

Explanation:

You asked and I responded

How does the speaker structure this part of the argument? Match each sentence to what it accomplishes. Match Term Definition Picture this: It's Spring Break, and you fly off to some country where there's lush rainforests and beautiful, blue coastlines to explore. A) State the claim of the argument There's also people in need, so you decide to blend your vacation with volunteering. B) Recognize the counterclaim Volunteering as a tourist, or voluntourism, seems like a great way to explore new regions and help people at the same time. C) Establish a problem with the counterclaim However, this D) Get the audience's attention While many teens might view traveling and volunteering abroad as a worthwhile adventure, there are more genuine and effective ways to make a difference. E) Establish the topic

Answers

Answer:

Picture this: E

There’s also people: A

Volunteering as a tourist: D

However, this: B

While many teens might view : C

Explanation:

The speaker's structuring of the text has been indicated below:

D. Get the audience's attention: Picture this: It's Spring Break, and you fly off to some country where there's lush rainforests and beautiful, blue coastlines to explore.

E. Establish the topic:  There's also people in need, so you decide to blend your vacation with volunteering.

A) State the claim: Volunteering as a tourist, or voluntourism seems like a great way to explore new regions and help people at the same time.

B) Recognize the counterclaim: However, this

C) Establish a problem with the counterclaim: While many teens might view traveling and volunteering abroad as a worthwhile adventure, there are more genuine and effective ways to make a difference.

What is a text structure?

Text structure refers to the manner of arranging the flow of ideas in a text.

The speaker in this argument began by getting the audience's attention, establishing a topic, stating a claim, and addressing a counterclaim.

Learn more about text structure here:

https://brainly.com/question/12053427

What book contain laws, commandments and rules by which we build a just and free society.

Answers

Answer:

Some options: The Bible, The Tanakh, The Quran,

Explanation: All these books contain commandments and rules by which we can build a just and free society.

30 POINTS!!!!

As you read the paragraph below, decide how relevant each detail is.



The two rowers carefully held both sides of the boat. One at a time each rower climbed into the boat and sat in her seat. When both rowers were in place, they grabbed the oars beside them. The oars were long and made of wood. The rowers pushed away from the dock.



Which fact above is the least relevant?
Select one:

a.
When both rowers were in place, they grabbed the oar beside them.

b.
The oars were long and made of wood.

c.
One at a time each got on and sat in their seat.

d.
The two rowers carefully held both sides of the boat.

Answers

The answer is B.
The oars were king and made of wood.

What effect does this speech have on George, Sam, and Rameck? They are shocked to hear about the varied quality of care. They are inspired and determined to make a difference. They are confused and eager to make sense of the situation. They are skeptical and quick to question the speaker.

Answers

Answer

what are the answers?

Explanation:

it could be b " they inspired and determined to make a difference" just doing that question

Answer:

it is b

Explanation:

because after they herd him say that they felt that they were ready and determined to change the world and help those in need

I needhelp with these questions right now​

Answers

Answer:

Sentence 2 repeats sentence 5 is unsorted and I would add more details reasons behind there opinion

sentence 5 states and unsupported opinion because it doesn’t tell why cities are dangerous

HELP PLSSS
What should the body of an essay contain in each paragraph?
A. one topic sentence and three supporting detail sentences
B. four supporting detail sentences about the topic
OC. three topic sentences and one supporting sentence
D two topic sentences and two supporting sentences

Answers

Two topic sentences and two supporting sentences

Answer:

Hi! I think it's A - one topic sentence and 3 supporting

Chapter 1: Beliefs and Teach
The following statements are muddled up. Add them in the correct order to the flowchart
below, to retell the story of Creation as described in Genesis chapters 2 and 3.
Adam and Eve lived in a garden full of wonderful trees and plants
They disobeyed God's command and ate from the tree
God told Adam and Eve not to eat from the tree of the knowledge
of good and evil
Adam and Eve became afraid and hid from God
God created the universe including the first humans, Adam and Eve
Adam and Eve had to leave the garden
Adam and Eve were tempted by the snake to eat from the forbidden tree
.

Answers

Answer:

1. God created the universe including the first humans, Adam and Eve

2. Adam and Eve lived in a garden full of wonderful trees and plants

3. God told Adam and Eve not to eat from the tree of the knowledge of good and evil

4. Adam and Eve were tempted by the snake to eat from the forbidden tree

5. They disobeyed God's command and ate from the tree

6. Adam and Eve became afraid and hid from God

7. Adam and Eve had to leave the garden

Which lines are written in iambic pentameter? Select 2 options.

The smoke of my own breath
And what I assume you shall assume
I never saw a moor
Yet certain am I of the spot
And summer's lease hath all too short a date
Nor lose possession of that fair thou ow'st

Answers

Answer:

the last two

Explanation:

Answer:

E. And summer's lease hath all too short a date

F. Nor lose possession of that fair thou ow'st

Explanation:

Edge 2021

please answer questions number 4, 14,15 and 19​
change into passive voice

Answers

4. Should the tiger be preserved?

14. weren't you told to be here by 6 O'Clock?

15. were any questions asked about me?

19. Why were I not informed the change of plan by anyone?

Okay I've finished ur work!!

Answer:

question no.. 4: yes we should..!

Part A

What is a central idea in the Newsela article "Washed-Up Plastics Become Art with a Vital Message"?

Many people now look for trash to pick up when they are visiting the beach.
Creating artwork can be both beautiful and horrifying.
Children enjoy the art displays of sea creatures.
Increased awareness of the dangers of ocean pollution are creating interest in Pozzi's art.

Question 2

Part B

Which detail from the text best conveys the answer in Part A?

"She now has more than 70 pieces in three exhibitions currently traveling throughout the United States. She also has requests from overseas."
"'It's the only thing he's liked all day,' his grandmother said."
"An army of about 10,000 volunteers in Oregon help her collect, prepare and assemble the beach trash into art."
"All of the art is made from plastic trash that washed ashore, including a great white shark…"

Answers

Answer:

A. Art can be used to send a message about environmental awareness.

B. "She wants people to then take action based on that knowledge. Signs next to each art piece suggest simple ways to reduce the problem."

Explanation: on the quiz

Answer:

the answer is c

Explanation:

i took the test

In which sentence is the word habitual used as it is listed in the dictionary entry?
He habitual jogged the same path through the park.
Each morning the man and woman eat their habitual breakfast in the diner.
It is apparent that it is her habitual to sing while painting.
It seems everyone is willing to put up with the habitual of the neighbor's gossip.

Answers

Number two is correct because habitual is something that is repeated

____ at school yesterday ? a)did you be b)did you go c)have you been d)where you​

Answers

Answer:

c) have you been

Explanation:

c) Have you been at school yesterday?

I have a question: Do you mean 'were' not 'where'? If so, "Were you at school yesterday", would make the most sense.

BRAINLIST PLS!

PLEASE HELP!!! BRAINEST AND 50 POINTS, I WOULD BE MOST GRATEFUL IF YOU HELP ME, THANK YOU!!!!!!!!!! READ THE ARTICLE FRIST!!

Answers

Answer:

Explanation:

On one hand, it should be free because many couples try to concieve in order to start a family, but they may not be able to pay the additional expenses. Everyone has the right to start a family, and cost should play no matter in it. On the other hand, it maybe shouldn't be free because there could be some people who can not afford to look after themselves, let alone raise a child. Another reason for why it should not be allowed is that IVF does not always work, as it is based on chances and is not a definitive answer

At Cindy's birthday each guest will get one-third of a medium sized pizza. There
will be 12 people at the party, including Cindy. How many pizza's does her mom
need?

Answers

Answer:

36

Explanation:

12 divided by 1/3= 36

3. Which technique increases the emotional impact of rhetoric?
symbolism
irony
connotative language
denotative language

Answers

Answer:

Connotative Language

Explanation:

I just took the test, enjoy

Read the summary paragraph for the article on service and answer the question that follows:
Service improves society, impacting the helpers as wel as those neoding assistance.It means being an active partcjpant in one's community, taking action
where it can be of benefit. Every person should make it a prionity to serve at least two
hours per week. It's an extremely important civic responsibility that is
invaluable to citizens most in need. Service creates improved comnmunities where people care about each other.

Which of the following makes a true statement about good summaries?

Good summaries include the writer's opinion on the article.

Good summaries focus on the support details from the body.

Good summaries provide all the data an author uses for support.

Good summaries objectively restate the thesis and crucial details.

Answers

Answer:

what

Explanation:

It this excerpt were made into a movie, which adaptation
would best allow the director to comment on current
politics?
Read the excerpt from Hamlet.
Voltimand:.On Fortinbras; which he, in brief, obeys,
Receives rebuke from Norway, and, in tine,
Makes vow before his uncle never more
To give the assay of arms against your majesty.
Whereon old Norway, overcome with joy,
Gives him three thousand crowns in annual fee,
And his commission to employ those soldiers,
So levied as before, against the Polack;
With an entreaty, herein further shown, [Giving a pper.]
O updating the setting to a modern city
O changing the costumes to modern fashion
O replacing the outdated terms with slang
O using actors with diferent ethnicities

Answers

The adaptation following the director's comment would be:

C). replacing the outdated terms with slang

Director

The director is defined as the individual who directs the characters to perform the scene accordingly and make the author's purpose serve successfully.

The third option most clearly assists the director in communicating the commentary over the recent politics i.e. 'substituting the ancient terms through idioms and jargon.'

Thus, option C is the correct answer.

Learn more about "Hamlet" here:

brainly.com/question/2010722

To prepare for the test, Andrew takes notes and studied.

Which answer corrects the error in verb tense?

Question 1 options:

To prepare for the test, Andrew took notes and studied.


To prepare for the test, Andrew was taking notes and is studying.


To prepare for the test, Andrew took notes and is studying.


To prepare for the test, Andrew takes notes and will study.

Answers

To prepare for the test, Andrew took notes and studied.

PLEASE HELP ASAP!!!!!!!!!!!!
Which shared psychological traits can advertisers use to influence buying decisions? (Select all correct answers.)

1. the need for belonging
2. empathy toward others
3. natural curiosity
4. the desire to be remembered

Answers

Answer:

the need of belonging is your answer

Explanation:

1 and 3 i hope this helps you

PLEASE HELP ME ANSWER THIS QUESTION

Which of the topics listed would you most likely be able to research using the library or internet, and would you most likely not be able to research?

Answers

Answer: the internet and library can help with the American revolution and photosynthesis

Answer:

The topics listed would you most likely be able to research using the library or Internet would be "the process of photosynthesis" and "the American Revolution", and those which you would most likely not be able to research are "the number of shoes you own" and "your best friend's favorite childhood memory"

Explanation:

1. Only some prepositions have objects.
True
False
2.A preposition creates a relationship between its object and another word in the sentence.
True
False

Answers

Answer:

a :)

Explanation:

What is Consensual Means

Answers

Answer:

existing or made by mutual consent without an act of writing a consensual contract.

Explanation:

Answer:

Consensual means is a mutual consent without writing a consensual act; or a mutual consent based on or involving a consensual act.

Hope this helps, have an amazing day :)

Explanation:

Other Questions
The 12 students in the Environmental Club represent 20% of the students in the seventh grade. How many students are in the seventh grade? In 1965 King and his wife, Coretta Scott King, led demonstrators on ahistoric 54-mile march that took five days, from where to where? HELPPPPPPPPPPPPPPP!!!!!!!!!!! BRAINLIEST IS ON THE LINE!!!!!!!!!!!!!!!!!Write a summary for Macbeth Act 1 Scene 2. What is the answer to question 7, NH4C2H3O2 what country has not experienced balkanization? PLS HELP FAST, IM FAILING LOLWhat is true about life under slavery?A. Slave owners discouraged slaves from adopting elements of whitecultureB. Slave owners did not pay slaves for their work,c. Enslaved African Americans had equal rights to those of whitepeopleD. Slaves had a great deal of freedom other than choosing where towork. Match the expression with an equivalent expression 6( n + 4 ) = 3(2(8-2x4)+25divided by 5 )-(2(8 divided by 4x2)-7(7-2x3) can you please help me:) write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me Need answers for #3 please hep Identify the number of solutions for the equation below: What is (-3,4) (5,-2) in slope intercept form? How did the use of paper help contribute to the spread of Islam? The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.What is the best use of an atomic model to explain the charge of the particles in Thomsons beams?An atoms negative particles are surrounded by positive matter, so the positive particles are easier to remove.An atoms positive particles are surrounded by negative matter, so the negative particles are easier to remove.An atoms smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.An atoms larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.